ID: 1128624421

View in Genome Browser
Species Human (GRCh38)
Location 15:69185014-69185036
Sequence CAACTCTGAGTGGCAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128624421_1128624425 -8 Left 1128624421 15:69185014-69185036 CCAGTTTTTGCCACTCAGAGTTG 0: 1
1: 0
2: 2
3: 15
4: 126
Right 1128624425 15:69185029-69185051 CAGAGTTGTGGCGTGGATATTGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128624421 Original CRISPR CAACTCTGAGTGGCAAAAAC TGG (reversed) Intronic
902765190 1:18609705-18609727 AAACTCAAAGTGGCAGAAACGGG + Intergenic
905442938 1:38006045-38006067 CAACTTTGAGTAGCAAAAACAGG + Intergenic
907234050 1:53028657-53028679 AAACTCTGAGTGGCAGAATTTGG - Intronic
907940426 1:59082238-59082260 CAACTCTGAGTGGTGAAGACAGG + Intergenic
908331790 1:63078073-63078095 CAAATCTGAGTGAGAAAATCAGG + Intergenic
908667167 1:66506302-66506324 CACCTCTGGGTGGGAAACACAGG - Intergenic
909424876 1:75511670-75511692 CACTTCTTACTGGCAAAAACAGG - Intronic
909761101 1:79288447-79288469 CAACACTGAGGGGCAAAAAATGG + Intergenic
910207136 1:84759349-84759371 CAGCTCGGAGTGGAAAGAACTGG + Intergenic
911997516 1:104786077-104786099 CATTTCTCATTGGCAAAAACGGG - Intergenic
914974369 1:152346617-152346639 GAACTCTGGGTGGCCAAAATGGG - Intergenic
924094761 1:240539790-240539812 CATCTCTGAATTGCAAATACTGG + Intronic
924378837 1:243441991-243442013 CAGCTCTCTGTGGCAAAAAGAGG + Intronic
1065249585 10:23797100-23797122 CAGCTCTGAGAGGCCAAAGCAGG - Intronic
1068802871 10:61162007-61162029 AAAATCTGAGAGGCCAAAACTGG + Intergenic
1069819126 10:71216918-71216940 CAACTCTGAGGGTCAAAAGACGG - Intronic
1071886656 10:89958658-89958680 CATCTCTGAGTGGCAGAATCAGG + Intergenic
1072320105 10:94241214-94241236 CATCTCTGAGCAGCAGAAACAGG + Intronic
1073596034 10:104801130-104801152 CAACAATGAGTGGCAGAAATGGG - Intronic
1074275661 10:111999506-111999528 CAACTCTTAGAGGCAACAAAGGG - Intergenic
1075452645 10:122562756-122562778 CACCTCTGAATGGCAAACACAGG - Intronic
1076461575 10:130650729-130650751 CATCTTTGATTGGGAAAAACAGG - Intergenic
1078374814 11:10785004-10785026 CAACTGTGAGGGGCAAACGCTGG + Intergenic
1079419853 11:20276091-20276113 CAAGTCTGAGAGGCCAAAGCTGG - Intergenic
1080466793 11:32504973-32504995 CACCTGTGAGTGGCAAGAGCCGG + Intergenic
1085764915 11:79274305-79274327 CAAATCTGAGAGTGAAAAACGGG - Intronic
1085970113 11:81579144-81579166 CAATTCAGAATGGCAAAAGCAGG + Intergenic
1086936969 11:92755590-92755612 CACCTCGGAATGGCTAAAACAGG - Intronic
1091755418 12:3048152-3048174 CAACTCTCAGGGACAATAACGGG - Intergenic
1097293807 12:57942117-57942139 CAACAGTGAGTGACAAAAAAGGG - Intronic
1097727089 12:63087783-63087805 CAACACTGAGAGGCCAAAGCGGG + Intergenic
1100673644 12:96843543-96843565 CAAATCTCAGTGGCAATAAAGGG + Intronic
1100685199 12:96979863-96979885 AAACACTGGGTGGCAAAAAACGG + Intergenic
1104514605 12:129413026-129413048 TGACTCTCAGTGGCAGAAACTGG - Intronic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1110484422 13:76021227-76021249 CAAATCTGAATGGCAAGTACAGG + Intergenic
1111681528 13:91447626-91447648 CAACTCTGTGTGGAAAAAGTAGG + Intronic
1114222868 14:20712628-20712650 CACCTTTGAGTGGCAAGACCTGG - Intergenic
1118727879 14:68643157-68643179 CAAATGTGTGAGGCAAAAACTGG - Intronic
1125686749 15:41568102-41568124 CAGCTCTGAGAGGCACAAACTGG - Intronic
1126302053 15:47208105-47208127 CAGCTCTAAGTGGCAGAGACAGG - Intronic
1128262770 15:66243965-66243987 TAACCCTGAGTGACAACAACAGG - Intronic
1128624421 15:69185014-69185036 CAACTCTGAGTGGCAAAAACTGG - Intronic
1137417942 16:48302472-48302494 CAAAGCTGAGTGGCCAAAAGTGG + Intronic
1145006802 17:19342971-19342993 CAGCTTTGAGTGGCAGAACCTGG + Intronic
1146794528 17:35772040-35772062 CAACTGTGACTGGCAAAGATGGG + Intronic
1147636205 17:41966021-41966043 CACCTCTGGGTGGCATAATCAGG + Intergenic
1147987792 17:44316272-44316294 GAAATCTGAGCGGCAAAAATGGG - Intronic
1151433907 17:74082406-74082428 CCACTCTGAGTGTCTAAAAGGGG + Intergenic
1153175673 18:2369987-2370009 TAACTCTGAGTGGTAATAGCAGG + Intergenic
1160408223 18:78657481-78657503 GAACTCTGAGAGGCCAAGACGGG - Intergenic
1163269006 19:16238611-16238633 TATCTCTGAAAGGCAAAAACAGG + Intronic
926540808 2:14178832-14178854 CAGCTCTACATGGCAAAAACTGG - Intergenic
929774830 2:44922897-44922919 CAACAAAGAGTAGCAAAAACGGG + Intergenic
930165918 2:48203834-48203856 CAGCTCTGAGAGGCCAAAGCAGG + Intergenic
930702476 2:54472591-54472613 TAAGTCAGAGTGGTAAAAACAGG + Intronic
935853042 2:107243812-107243834 CAACTCTGAGTGGTAAACAAAGG - Intergenic
939171962 2:138706518-138706540 CAACTATAACTGGCATAAACAGG - Intronic
942208532 2:173647741-173647763 CAACTGTGAGCTGCAAAAAAAGG + Intergenic
944844338 2:203653898-203653920 CAACTCTAAGTGGCACTAACTGG - Intergenic
947050159 2:226032544-226032566 CACCCCTGGGTGGCAAAACCTGG - Intergenic
1174240019 20:49126092-49126114 CAACTCTCAGAAGCAAAAACAGG + Intronic
1181634212 22:24166928-24166950 CAAGTCTGAGTGGCAAACAGTGG - Exonic
1181903885 22:26177930-26177952 CAACTGTGAGTGGCAGAGCCAGG + Intronic
1182140866 22:27956976-27956998 CAAAACTGTGTGGCAAGAACAGG + Intergenic
1184746738 22:46460613-46460635 CAACCCTGAGAGGCAAACACGGG - Intronic
1185164459 22:49252578-49252600 CAATGCAGTGTGGCAAAAACTGG - Intergenic
949457260 3:4252507-4252529 AAACCCTGAGTGGCAAAAGTAGG + Intronic
950741154 3:15052668-15052690 CAACTTTGAGTGGCAGGCACAGG + Intronic
951060830 3:18205100-18205122 CAACTAAGAATTGCAAAAACTGG + Intronic
952140632 3:30475178-30475200 CAACTCTGAGTGAGAAAAACTGG - Intergenic
952728778 3:36617942-36617964 CAACTGTAAGTGGCAAATCCAGG + Intergenic
956337477 3:68180284-68180306 GCACTCTGAGTGGCCAAAGCAGG - Intronic
958058683 3:88448686-88448708 CACCTCCAAGTGGCAAAAGCTGG - Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
964225882 3:154401018-154401040 CAACACTAAGTGGTAAAACCAGG - Intronic
965479096 3:169194729-169194751 CAACTTGGAGTGGCAAATTCTGG - Intronic
965679360 3:171234507-171234529 CACCTCTGAGTGACAGAAAATGG + Intronic
966539905 3:181077773-181077795 CAGCAGTGATTGGCAAAAACTGG + Intergenic
967645221 3:191914707-191914729 AAACTTTGAGTAGCTAAAACTGG - Intergenic
968193022 3:196684409-196684431 AGACTATGAGTGACAAAAACTGG + Intronic
974487642 4:62525427-62525449 CAACTCTGAATGGGAGAAACTGG - Intergenic
974842605 4:67315609-67315631 CAATTCTGTGTGTCAAAAAAAGG + Intergenic
977083993 4:92571046-92571068 TCATACTGAGTGGCAAAAACTGG - Intronic
977978460 4:103294846-103294868 CAACTTTTAGTGGGAAAAAAGGG - Intergenic
978576347 4:110194180-110194202 CAGCTCTTAGTGAGAAAAACAGG + Intronic
979972770 4:127158198-127158220 CAACTCTTTGTTGTAAAAACTGG + Intergenic
980424505 4:132608795-132608817 CAACTCTGAGTGAAGAAAAGTGG + Intergenic
989335989 5:40317405-40317427 CACTCCTGAGTGGGAAAAACAGG + Intergenic
990015333 5:51054563-51054585 AAATTCTGAGTGGAAGAAACTGG - Intergenic
990036596 5:51329103-51329125 CAACTCACTGTGTCAAAAACAGG - Intergenic
990223153 5:53618333-53618355 CAACTCCAAGTAGCAAAAAAAGG - Intronic
991231794 5:64342166-64342188 TCACTCTCAGTGGCAATAACTGG + Intronic
996067103 5:119091456-119091478 CAACACTGGGAGGCCAAAACAGG - Intronic
996524202 5:124460576-124460598 AGACTCTGAGGAGCAAAAACTGG + Intergenic
997809775 5:136956006-136956028 CAAACCTGAGGGTCAAAAACAGG - Intergenic
999470967 5:151855133-151855155 CATCTTTGAGTGGCAGGAACAGG - Exonic
1000186081 5:158859383-158859405 CAACTCCGAATGGGAAAATCTGG - Intronic
1001626714 5:173142350-173142372 CAACTCTGTGAGGTAAAAACGGG - Intergenic
1002119113 5:176987881-176987903 AAACTCTGAGAGGCCAAGACTGG + Intronic
1005935887 6:30520674-30520696 CAACCCTGTGTGTTAAAAACAGG + Intergenic
1009791575 6:68408148-68408170 CAAGTCTGAGTGATATAAACCGG + Intergenic
1010585813 6:77657828-77657850 GAACTCAGAGAGGCAAAAGCAGG - Intergenic
1011164258 6:84428484-84428506 CACCTCTGAGTGCCACCAACAGG + Intergenic
1013115805 6:107102911-107102933 CATCACTGAGTGGCAGAACCTGG + Intronic
1014581909 6:123148098-123148120 CAAGACTGAGTGGGAAAGACAGG - Intergenic
1014655424 6:124097859-124097881 CTAGTCTGATTGGCAAAAGCTGG + Intronic
1015798844 6:137040590-137040612 GAACTCTTAGTGGCCAAAGCTGG + Intronic
1015882221 6:137881017-137881039 GATCTCTGAGTGGAAAGAACAGG - Exonic
1022973049 7:35534958-35534980 CAACTCTGAGTGGTGAGAAAGGG + Intergenic
1023286564 7:38627208-38627230 TAACTCTCAGTGGCCCAAACTGG - Intronic
1023569764 7:41559801-41559823 CAGCTCTGAGGGGCAAAAATAGG - Intergenic
1023954992 7:44878070-44878092 TAACTCTGAGTTGCAAGATCAGG - Exonic
1024840715 7:53584221-53584243 TAACTTTGAGTGGGAAAAACAGG - Intergenic
1026714346 7:72774190-72774212 CTAGTCTGACTGGCAGAAACAGG - Intronic
1027610694 7:80356945-80356967 TTACTTTTAGTGGCAAAAACTGG - Intergenic
1029952765 7:104604313-104604335 CAGCTCTGAGCAGCAAAACCAGG + Intronic
1031150492 7:118048505-118048527 AAAATGAGAGTGGCAAAAACAGG - Intergenic
1032018637 7:128394656-128394678 CACCTCTTAAGGGCAAAAACGGG + Intronic
1033178869 7:139154441-139154463 AAACTCTTAGTGGAAAACACAGG - Intronic
1033972754 7:147062564-147062586 CTATTATGAGTGGCAAAAATGGG - Intronic
1034144490 7:148856710-148856732 AAACTCTCAGTGGCCAAAGCTGG + Intronic
1037288891 8:17330131-17330153 GAAATCTGAGTGTCACAAACAGG - Intronic
1042891031 8:73610288-73610310 CAACTCTGGGTGGCAAAGGCAGG + Intronic
1043801115 8:84610804-84610826 GAGCTCTGAGTGGCCAAAGCTGG - Intronic
1045373542 8:101549240-101549262 CAAGTGTGAGAAGCAAAAACAGG + Intronic
1046216284 8:111152136-111152158 TAACTCTGAGTGGCAGGGACTGG + Intergenic
1048497134 8:134944688-134944710 CAACTCTAACTGGCCTAAACAGG - Intergenic
1050161274 9:2721065-2721087 CATTTATGATTGGCAAAAACTGG - Intronic
1052221336 9:26026899-26026921 CAAGCCTAAGTGGCAGAAACTGG + Intergenic
1052246145 9:26337595-26337617 GAACTCTCAGTGCTAAAAACTGG - Intergenic
1056152054 9:83800746-83800768 CACCTGTGATTGGCTAAAACTGG - Intronic
1056898515 9:90575501-90575523 AAACTCCCAGTGGCCAAAACTGG + Intergenic
1059644105 9:116247225-116247247 CAATTCTGAGAGGGAAAAAGAGG + Intronic
1059963303 9:119588960-119588982 CAACTCTGAGAGGTGAAGACTGG - Intergenic
1186282318 X:8006432-8006454 GAATTCTGAGTGACAAAGACTGG + Intergenic
1186795987 X:13046626-13046648 CAACTCTGGGTTGCGGAAACAGG + Intergenic
1189447343 X:41093111-41093133 CAACACTGGGAGGCCAAAACAGG - Intronic
1190393058 X:49951802-49951824 AAACTCTGTGTGGCACAAAATGG + Intronic
1191096412 X:56677723-56677745 TCACACTGAATGGCAAAAACTGG + Intergenic
1192722225 X:73711158-73711180 CAACACTGGATGGCAAAAGCAGG - Intergenic
1193144180 X:78060389-78060411 CGTCTCTGAGTGGCAAAGAAGGG + Intergenic
1195242403 X:102965518-102965540 AAAATCTGAGTGACAAAAAAGGG + Intergenic
1199712638 X:150481172-150481194 CATCCCTGAGTGGGAATAACTGG + Intronic