ID: 1128624554

View in Genome Browser
Species Human (GRCh38)
Location 15:69186240-69186262
Sequence GACCCACTGTCAGAGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128624545_1128624554 18 Left 1128624545 15:69186199-69186221 CCTCCAGGGTATGAGGCAGGACC 0: 4
1: 16
2: 80
3: 168
4: 411
Right 1128624554 15:69186240-69186262 GACCCACTGTCAGAGAGGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 230
1128624551_1128624554 -4 Left 1128624551 15:69186221-69186243 CCTCTCTGGAGGGTCTTAAGACC 0: 1
1: 0
2: 1
3: 10
4: 83
Right 1128624554 15:69186240-69186262 GACCCACTGTCAGAGAGGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 230
1128624543_1128624554 22 Left 1128624543 15:69186195-69186217 CCTTCCTCCAGGGTATGAGGCAG 0: 3
1: 16
2: 74
3: 164
4: 657
Right 1128624554 15:69186240-69186262 GACCCACTGTCAGAGAGGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 230
1128624546_1128624554 15 Left 1128624546 15:69186202-69186224 CCAGGGTATGAGGCAGGACCCTC 0: 4
1: 13
2: 46
3: 93
4: 269
Right 1128624554 15:69186240-69186262 GACCCACTGTCAGAGAGGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 230
1128624550_1128624554 -3 Left 1128624550 15:69186220-69186242 CCCTCTCTGGAGGGTCTTAAGAC 0: 1
1: 0
2: 1
3: 13
4: 99
Right 1128624554 15:69186240-69186262 GACCCACTGTCAGAGAGGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128624554 Original CRISPR GACCCACTGTCAGAGAGGCT GGG Intronic
900313121 1:2043953-2043975 CACATACTGTCAGAGGGGCTGGG - Intergenic
900720349 1:4172010-4172032 GACCCAATGTCTGGGAGCCTGGG - Intergenic
901391235 1:8947635-8947657 AGCCCACTGTCTCAGAGGCTGGG - Intronic
901659594 1:10790089-10790111 GACCCACTCGCAGAGCGGCGTGG + Intronic
902187006 1:14733152-14733174 GTCCCTCTGTCAGAAAGTCTGGG - Intronic
902678396 1:18025398-18025420 GAGTCAATGTCAGAGAGGCCTGG - Intergenic
902977360 1:20098593-20098615 GGCCCACTGGCACAGAGCCTAGG + Intergenic
904029361 1:27524280-27524302 GACCCAGTGGCAGACAAGCTGGG + Intergenic
904910149 1:33928575-33928597 CACCCACTGGCTGAGTGGCTTGG - Intronic
905472781 1:38206083-38206105 GGCTCACTGCCAGTGAGGCTGGG - Intergenic
906445753 1:45896591-45896613 GACCCACAGTCAGAAAGGTTGGG + Intronic
907314344 1:53559072-53559094 GACCCAGTGTGAGAAAGGCCTGG + Intronic
907527032 1:55059715-55059737 CACCCACTGCCCGCGAGGCTTGG + Intronic
908156672 1:61360409-61360431 GACACAGGCTCAGAGAGGCTAGG - Intronic
911799543 1:102118360-102118382 GATCCACTATCAGAAAGGCTGGG + Intergenic
911890917 1:103371104-103371126 AACCCACAGTCAGGGAGGTTGGG - Intergenic
912256614 1:108065958-108065980 GACCCACCATGATAGAGGCTTGG + Intergenic
913675885 1:121139770-121139792 GACCTACAGTCAGATAGGGTAGG - Intergenic
914027781 1:143927710-143927732 GACCTACAGTCAGATAGGGTAGG - Intergenic
915145961 1:153795796-153795818 GGCCCACTCTCAGCGAGTCTGGG - Intergenic
916520418 1:165558392-165558414 GACCCCCTGTGTGAGAGGCAAGG + Intronic
917956286 1:180102057-180102079 GACCCACAGTCAGAAAGGTAGGG + Intronic
920463253 1:206158607-206158629 GACCTACAGTCAGATAGGGTAGG - Intergenic
920509275 1:206538679-206538701 GCCCAACCTTCAGAGAGGCTGGG + Intronic
921525301 1:216210004-216210026 GACCCACAGTCAGACAAGGTAGG - Intronic
922156927 1:223047819-223047841 GACCCACCCTCAGTGAGGGTGGG - Intergenic
922504617 1:226119278-226119300 GAAACAGTCTCAGAGAGGCTGGG + Intergenic
922565775 1:226600761-226600783 GACCCACTGGGAGAGTGGGTGGG - Intronic
922891679 1:229066590-229066612 GATGCACAGTCAGAAAGGCTGGG + Intergenic
1063082914 10:2785325-2785347 CCCACACTCTCAGAGAGGCTTGG + Intergenic
1063104888 10:2984552-2984574 GACCCACTCTCTGCCAGGCTGGG - Intergenic
1063691613 10:8292905-8292927 GACCCACAGTCAGATAAGGTAGG + Intergenic
1064655456 10:17551433-17551455 GACCCACAGTCAGAAGGGCAGGG - Intergenic
1066397730 10:35042526-35042548 GACCCACAGTCAGAAAGGTAGGG - Intronic
1070727610 10:78803039-78803061 GTCCCACTTGGAGAGAGGCTGGG + Intergenic
1071836010 10:89417616-89417638 GACTGACTGTGAGAAAGGCTGGG + Exonic
1071966251 10:90856418-90856440 GACCATCTGTCAGGGATGCTAGG - Intronic
1075120402 10:119660268-119660290 GAACCACAGTCAGTGCGGCTGGG + Intronic
1075385108 10:122049909-122049931 GACCAACTCTCAGAGTGGTTAGG + Intronic
1076933843 10:133554755-133554777 GGCCCACTGTGAGAGCGTCTCGG + Intronic
1077128638 11:957482-957504 GACCCACAGTCAGACAAGGTAGG + Intronic
1078138485 11:8672518-8672540 GAAACAGTGTTAGAGAGGCTGGG + Intergenic
1080404224 11:31964554-31964576 GATCCCCTTTCAGAGTGGCTTGG - Intronic
1080413449 11:32047972-32047994 GAACCACTGTCACACATGCTTGG + Intronic
1081749449 11:45499438-45499460 GACCCACCATCAGAAAGGCATGG - Intergenic
1084549783 11:69834429-69834451 GATCCTCTGTCAGAGAGGGAAGG - Intergenic
1089190837 11:116652025-116652047 GACCCAGTGTCAGACAAGCCTGG + Intergenic
1089659924 11:119979057-119979079 GCCCCTCTGTCAGAAAGGGTGGG + Intergenic
1090615021 11:128506738-128506760 GACCGACCGTGGGAGAGGCTGGG + Intronic
1090859284 11:130638747-130638769 GCCCCACATTCAGAGAGGCGGGG + Intergenic
1091413227 12:257884-257906 TACCCAATTCCAGAGAGGCTTGG + Intronic
1091669472 12:2442535-2442557 CACCCACTGTCAGAGGAGCAGGG + Intronic
1091935790 12:4433545-4433567 GATGAACTGTCAGGGAGGCTGGG - Intronic
1092495121 12:8985916-8985938 GACCCACAATCAGAAAGGCAGGG + Intronic
1096414859 12:51404244-51404266 GACCAAATGCAAGAGAGGCTGGG + Intronic
1096557463 12:52412085-52412107 GAGCCAGTGTGAGAGAGGGTGGG + Intergenic
1096845328 12:54403469-54403491 GACCTTCTGTCAGAGGAGCTGGG - Intronic
1097966832 12:65590435-65590457 GACCTTCTGTCAGAGACTCTGGG - Intergenic
1099474064 12:83086271-83086293 GCCCCACTGTCTGAGAAGCGAGG - Intronic
1099849518 12:88074684-88074706 GACCCACAGTCAGAAAGGCAGGG - Intronic
1100635482 12:96431260-96431282 GACCCACAGTCAGAAAGGTGGGG + Intergenic
1103351500 12:120286831-120286853 GACCCACTACCAGAGAGGTTCGG - Intergenic
1105068021 12:133216955-133216977 ATCCCATTGTCAGAGAGGCCAGG + Intergenic
1106544433 13:30717860-30717882 GACCCACAGTCAGAAAGGTGGGG + Intronic
1106647859 13:31656115-31656137 GATCCACTGAATGAGAGGCTGGG - Intergenic
1106908245 13:34432006-34432028 GACCCACTGTCAGACAGACTTGG + Intergenic
1107359897 13:39606975-39606997 GACCCACAGTCAGAAAGGAGGGG - Intergenic
1108725336 13:53174763-53174785 GAGCCAAGGGCAGAGAGGCTAGG + Intergenic
1109459630 13:62638797-62638819 GACCCACAGTCAGAAAGGCATGG + Intergenic
1110440177 13:75518632-75518654 GACCCACACTCGGAGCGGCTGGG + Intergenic
1110488380 13:76072973-76072995 GACCCACAATCAGAAAGGCAGGG - Intergenic
1112562310 13:100525704-100525726 CACCTACTGGCAGAGAGGGTAGG + Intronic
1118205230 14:63716659-63716681 GACTCACTGTCACCCAGGCTGGG - Intronic
1118718858 14:68579786-68579808 GCCCCACTGTCAGAGTGTCCAGG + Intronic
1122383314 14:101325995-101326017 GAACCATTGCCAGAGAGCCTGGG + Intergenic
1122985765 14:105210923-105210945 CAGCCAGGGTCAGAGAGGCTAGG - Intronic
1126846596 15:52766257-52766279 GAAACCCTGTCAGAGAGGTTAGG + Intronic
1127174626 15:56340306-56340328 GACTCACTGTGAGATAGACTTGG + Intronic
1128624554 15:69186240-69186262 GACCCACTGTCAGAGAGGCTGGG + Intronic
1129091137 15:73152280-73152302 AACCCACCATCAGAAAGGCTGGG - Intronic
1129231136 15:74197745-74197767 GACTCACTGACAGCGAGGCCAGG + Exonic
1129930464 15:79406393-79406415 GACCCACTGTGAGAGAATTTGGG + Intronic
1130034023 15:80341671-80341693 GTCCCAATCCCAGAGAGGCTGGG - Intergenic
1130878106 15:88031910-88031932 AACCCACTGTCAGGAAGCCTGGG + Intronic
1130961103 15:88659171-88659193 GACCCACTGAGAGCGGGGCTTGG - Intergenic
1131023222 15:89117503-89117525 GACCCACTGTGCACGAGGCTTGG - Intronic
1131796115 15:96018332-96018354 AACTCACTGCAAGAGAGGCTTGG + Intergenic
1132991863 16:2799558-2799580 GCCCCAGTGGCAGTGAGGCTGGG + Intergenic
1133829669 16:9310089-9310111 GAACCAGTGTCACAGAGGGTGGG - Intergenic
1136114805 16:28087813-28087835 GACCAGGTGTCACAGAGGCTGGG + Intergenic
1140020537 16:71234112-71234134 GCCCCAATGCCAGAGAGGCCAGG + Intergenic
1143824166 17:9590657-9590679 CACCCCCTGTCAAAGAGACTAGG + Intronic
1144356415 17:14451129-14451151 GACCAAGTGACAGGGAGGCTAGG + Intergenic
1144519314 17:15943973-15943995 GACCCACAGGCAGAGAGGGAGGG + Intergenic
1148584027 17:48764221-48764243 GACCCACTTTCACAGTGGGTTGG - Intronic
1149008644 17:51832081-51832103 AACCCATTGTCAGAGAGACCTGG + Intronic
1149500313 17:57147523-57147545 GACCCACAATCAGAAAGGCAGGG - Intergenic
1150021262 17:61615789-61615811 GCCCAACTGTCAGAGAGGGGAGG + Intergenic
1153415224 18:4838672-4838694 GACCCACAGTCAGAAAGGTGAGG + Intergenic
1153503450 18:5771281-5771303 AACCCACAGTCAGAAAGGCAGGG + Intergenic
1153725221 18:7947265-7947287 CACCCACTGTCAGGGCTGCTGGG - Intronic
1156842892 18:41630332-41630354 TACCCCCAGTCAGAGAGCCTTGG - Intergenic
1157180797 18:45496403-45496425 GACCCACTGTCAGTGTGGGTGGG + Intronic
1157850902 18:51050065-51050087 GAACCACTGTCAGCCAGGCACGG + Intronic
1158406468 18:57164341-57164363 GACCCAGAGTCAGTGAGACTGGG - Intergenic
1158797901 18:60870835-60870857 ATCCCACTGCCAGAAAGGCTGGG - Intergenic
1160272365 18:77398666-77398688 GACTCACTGTCCCAGAGGCTGGG + Intergenic
1160493180 18:79354847-79354869 GACCCACGGTTGGAGAGGCTGGG - Intronic
1160539843 18:79614469-79614491 GACCCACTGGCAGAGTCCCTGGG - Intergenic
1160584262 18:79903967-79903989 TCCCCACTGTCAGAGGGCCTTGG + Exonic
1162261331 19:9536720-9536742 CTCACACTGTCAGAGAGGCAAGG + Intronic
1162475390 19:10896485-10896507 GACCCACCGTCACACAGGATAGG - Intronic
1162602519 19:11679708-11679730 GACCCACAATCAGAAAAGCTGGG + Intergenic
1165294721 19:34917234-34917256 GACCCACAATCAGAAAGGCAGGG + Intergenic
1166749229 19:45156802-45156824 CAGCCACTTTCAGAGAGGCCTGG + Intronic
1167880986 19:52457168-52457190 GACCCACAATTAGAAAGGCTGGG - Intronic
1168125909 19:54282752-54282774 GATCCACTATCAGAAAGGCAGGG - Intergenic
1168150469 19:54444787-54444809 GACCCACTCTCAGTGTGGGTGGG + Intergenic
926359221 2:12069581-12069603 TACTGATTGTCAGAGAGGCTGGG - Intergenic
926388529 2:12362999-12363021 GACCCACCCTCAGTGAGGGTGGG + Intergenic
929365437 2:41150173-41150195 GAGCCTCTGTCACACAGGCTGGG + Intergenic
930399119 2:50860760-50860782 GACCCAGAGTGAGAGAGGATAGG + Intronic
931435627 2:62243701-62243723 GACCCACAATGAGAGAGGCAGGG - Intergenic
933351272 2:81155009-81155031 GCCCCATTTTCAGAGAGGCTTGG + Intergenic
937285415 2:120747780-120747802 GCCCCACTGTCAGAGTCCCTGGG - Intronic
937327633 2:121000973-121000995 GACCCAAAGTCACAGAGGCAAGG + Intergenic
937356083 2:121199039-121199061 GACCCACAGTCAGAAAGGCAGGG - Intergenic
938647058 2:133342503-133342525 GAGCCAGAGTCAGAGAGGCCTGG + Intronic
940669583 2:156650726-156650748 GACCCCATGTCAGGGAGACTGGG - Intergenic
943086352 2:183316539-183316561 AACCCCCTGTCAGAGCAGCTGGG - Intergenic
943918110 2:193664476-193664498 TTCCCACTTTCAGAGAGGTTGGG + Intergenic
945609283 2:211978193-211978215 ACCCAACTGCCAGAGAGGCTAGG - Intronic
946152563 2:217786113-217786135 GATCCAGTGACAGAGAGTCTAGG - Intergenic
947537635 2:230950813-230950835 GACCCACAATCAGAAAGGCGGGG - Intronic
948082120 2:235214928-235214950 GTCCCAGTGTCAAAAAGGCTGGG - Intergenic
1170394573 20:15912076-15912098 GACCCACTGTCAAAACAGCTTGG - Intronic
1172198856 20:33111478-33111500 GAACCAGTCCCAGAGAGGCTCGG + Exonic
1173173133 20:40743338-40743360 GACACAGTCTCAGAAAGGCTGGG - Intergenic
1176148832 20:63578666-63578688 AACCCACTGGCAGGGACGCTGGG - Intergenic
1176305740 21:5122227-5122249 GACCCACAGTCAGAAAGGCGGGG - Intronic
1176408011 21:6432129-6432151 GACTCACTGTCTGACAGGCAGGG + Intergenic
1176427665 21:6558766-6558788 GACCCACAGGCAGAGAGGTCTGG + Intergenic
1177261013 21:18730105-18730127 CACACACTGTAAGAGAAGCTGGG - Intergenic
1179683502 21:43040455-43040477 GACTCACTGTCTGACAGGCAGGG + Intergenic
1179703157 21:43167083-43167105 GACCCACAGGCAGAGAGGTCTGG + Intergenic
1179851318 21:44139804-44139826 GACCCACAGTCAGAAAGGCGGGG + Intronic
1182371086 22:29811532-29811554 TAACCACTTTCAGAGAGGCCTGG + Intronic
1183684718 22:39355121-39355143 GAAGCACTGTCCCAGAGGCTCGG + Intronic
1184299708 22:43550218-43550240 GACACAAGCTCAGAGAGGCTGGG + Intronic
1184493509 22:44824116-44824138 GACCCACTGGCACAGCGGCAGGG + Intronic
1184666306 22:45990863-45990885 GACCCACTGTCTCAGAGGTTAGG - Intergenic
952327409 3:32334006-32334028 GTCCCTCTGTCACCGAGGCTGGG + Intronic
953024386 3:39136551-39136573 GCCCTACTGGCAGATAGGCTAGG + Intronic
953461207 3:43082511-43082533 CACACACTGACAGAGAGGCCTGG + Intronic
953928354 3:46993704-46993726 GACCCACTCTAACAAAGGCTGGG - Intronic
953957093 3:47240046-47240068 GAACCACTGGCTGAGGGGCTGGG + Intronic
957671044 3:83303192-83303214 GACCCACAATCAGAAAGGCAAGG + Intergenic
961070274 3:123917696-123917718 TACCCACTGTTAGAGAAGCCTGG + Intronic
965082625 3:164054098-164054120 GACCCACAATCAGAAAGGCTGGG + Intergenic
965463918 3:169003524-169003546 GACTGAGGGTCAGAGAGGCTAGG + Intergenic
965585590 3:170315003-170315025 CACACACTGTGAGAGATGCTAGG - Intergenic
967022300 3:185533441-185533463 GACCCACACTCAGAGAGGTTAGG + Intronic
969702126 4:8773518-8773540 GCCCCACTGTCACCGAGGCCTGG - Intergenic
970628844 4:17919812-17919834 GACCCACAGTTAGAAAGGCAGGG - Intronic
970993254 4:22236983-22237005 GGCTGACTGTCAGAGAGGGTAGG - Intergenic
971241918 4:24897089-24897111 GACACGCGGTCAGAGAGGCATGG + Intronic
972767011 4:42160331-42160353 GACCCACAGTCAGAAAGGTGGGG + Intergenic
977046632 4:92076547-92076569 GACCCACAATCAGAAAGGCAGGG - Intergenic
980765802 4:137301907-137301929 GACCCACGATCAGAAAGGCCAGG + Intergenic
983095329 4:163554505-163554527 GCCACATGGTCAGAGAGGCTTGG + Intronic
983255866 4:165399913-165399935 AACCCACTCTTAGAGAGGCTGGG - Intronic
983531186 4:168811240-168811262 GATCCACTCTCAGAGCGTCTTGG + Intronic
984222353 4:176993872-176993894 GACCCACTGTGAGACAGCCTTGG + Intergenic
984977535 4:185242733-185242755 GACCCACAGTCAGAGAGGCAGGG + Intronic
985052145 4:186001564-186001586 CTCCTACTGTTAGAGAGGCTTGG + Intergenic
987706675 5:21468286-21468308 GACCCACAGTCAGATAAGGTAGG - Intergenic
988479784 5:31620090-31620112 GACCCAGTGTCAGTGAGGCCAGG + Intergenic
989365507 5:40651435-40651457 GACCCACAGTGAGAGAGGGGAGG - Intergenic
992451341 5:76879030-76879052 CACCGGCTGTTAGAGAGGCTAGG - Intronic
993025022 5:82635327-82635349 GATCCACTGACAAAGAGGCATGG - Intergenic
994699836 5:103120178-103120200 GAACCACGGTCAGAAAGGTTAGG + Intronic
996847153 5:127912560-127912582 CTCCCACTATCACAGAGGCTCGG - Intergenic
997079978 5:130726703-130726725 GACCCACAGTCAGAAAGGTGGGG - Intergenic
997791527 5:136766623-136766645 GACTCACCGTCAGCCAGGCTGGG - Intergenic
999990664 5:157047161-157047183 GACCCACAATCAGAAAGGCGGGG - Intronic
1001935562 5:175701187-175701209 GACCCAGTTTCAGAGCTGCTTGG - Intergenic
1002322060 5:178382160-178382182 GGCCGACGCTCAGAGAGGCTGGG + Intronic
1002625988 5:180529992-180530014 TGCCCACTGGCAGAGATGCTGGG - Intronic
1004046592 6:12031146-12031168 GACCCACAGGCAGAGAGTCAAGG - Intronic
1004294087 6:14394608-14394630 GACCCACAGTCAGAAAGGTGGGG - Intergenic
1005997319 6:30939421-30939443 GAACCACCGTCCTAGAGGCTTGG + Intergenic
1007248834 6:40482151-40482173 GAGCTACTGTCAGAGAGGGGTGG + Intronic
1007560873 6:42807212-42807234 GTCTCACTGTCACCGAGGCTGGG + Intronic
1007610358 6:43145107-43145129 TCCCCACTGTGGGAGAGGCTAGG + Intronic
1013510560 6:110840729-110840751 GACCCACAGTCAGAAAGGGTTGG + Intronic
1015774097 6:136795996-136796018 GACCCACAGTCAGAAAGGTGGGG + Intergenic
1016440003 6:144073744-144073766 CACCCACTATCAGACAGGCGGGG - Intergenic
1018321067 6:162608974-162608996 GCCTCACTGGCAGAGAGGCGAGG - Intronic
1018740179 6:166722511-166722533 GGCCCACAGCCACAGAGGCTGGG + Intronic
1019643968 7:2119344-2119366 GGGCCACTGTCAGAAAGGGTGGG - Intronic
1020270036 7:6589604-6589626 AGCCCGCAGTCAGAGAGGCTGGG + Intergenic
1021631150 7:22648878-22648900 GACCAACTGTGGGAGGGGCTAGG - Intergenic
1021725010 7:23540321-23540343 GACCCACAATCAGAAAGGCAGGG - Intergenic
1022412561 7:30150432-30150454 GACTCACTGTGCTAGAGGCTAGG + Intronic
1024884506 7:54125873-54125895 GACCCACTGTAAGTCAGGCCTGG + Intergenic
1026624633 7:71981282-71981304 GACCCACAATCAGAAAGGCAGGG - Intronic
1029971490 7:104793950-104793972 GAATCACTCTTAGAGAGGCTCGG + Intronic
1031919941 7:127593146-127593168 TACCCACTGGCAGAGCAGCTGGG + Intronic
1032071891 7:128812931-128812953 TAACCACTGTCAGGGAGGCAGGG + Intronic
1034490827 7:151392310-151392332 GTCCAAGTGTCTGAGAGGCTGGG - Intronic
1035684691 8:1514710-1514732 GTCCCACAGTCAGTGAGGATGGG + Intronic
1036622135 8:10431209-10431231 GACCCACTGAGAGACAGACTTGG - Intergenic
1036707714 8:11057576-11057598 TTCCCACGGTCACAGAGGCTGGG + Intronic
1037534034 8:19808383-19808405 GACCCACTGTGAGATGGGCTTGG - Intergenic
1037949849 8:23011839-23011861 AACCCAGTGTCAGAGCTGCTGGG + Intronic
1039804544 8:40987080-40987102 GACCCACAGTCAGAAAGGCAGGG + Intergenic
1041669503 8:60478519-60478541 GACCCACAATCAGAAAGGCAGGG + Intergenic
1042149565 8:65767552-65767574 GACTCACAGTCAGAAAGGCCAGG - Intronic
1044908632 8:97032443-97032465 GTCCAACTGTGTGAGAGGCTAGG + Intronic
1048340846 8:133537384-133537406 GACCCACAGTCAGAAAGTCAGGG + Intronic
1048350635 8:133613139-133613161 GATACAGTGTCAGAGTGGCTTGG + Intergenic
1049370144 8:142260474-142260496 GGCCCACGGCCAGGGAGGCTGGG + Intronic
1049452439 8:142669583-142669605 CTTCCACTCTCAGAGAGGCTTGG - Intronic
1049690192 8:143954924-143954946 GACCCACTGTGCGCCAGGCTGGG + Intronic
1049861995 8:144905057-144905079 GACCCACAATCAGAGAGGTAGGG + Intergenic
1052119526 9:24694047-24694069 GACCCACAGCCTGAGAGACTTGG - Intergenic
1053351599 9:37417055-37417077 CACCCACTGCCCCAGAGGCTGGG + Intergenic
1056770544 9:89475195-89475217 GAACCAGTGTCACAGAGGCTGGG + Intronic
1060816108 9:126636093-126636115 GCCCCACTCTCACTGAGGCTAGG + Intronic
1061504237 9:131022066-131022088 GACCCACGGTCAGAAAGGTGGGG + Intronic
1061864152 9:133483870-133483892 GACCCACAGTCAGACAAGGTGGG + Intergenic
1061902177 9:133678552-133678574 GACCCACAGTCAGACAAGGTAGG - Intronic
1187469163 X:19552956-19552978 GACCCACTGTTAGAGAGCCCAGG - Intronic
1188883000 X:35513396-35513418 GACCCACAATCAGAAAGGCAAGG - Intergenic
1189367571 X:40400769-40400791 GACCAATGGTCAGAGAGGCCAGG - Intergenic
1190414067 X:50163978-50164000 GACCCACAGTCAGAAAGGTGGGG + Intergenic
1192055165 X:67766443-67766465 GACACAAGGTCAGAGAGGTTAGG - Intergenic
1193467795 X:81868871-81868893 GACCCAGCCTCAGAGGGGCTGGG + Intergenic
1196442117 X:115727580-115727602 GACCCACTGGAGGAGAGGCACGG + Intergenic
1196442777 X:115730534-115730556 GACCCACTGGAGGAGAGGCACGG + Intergenic
1196443445 X:115733334-115733356 GACCCACTGGAGGAGAGGCACGG - Intergenic
1196445769 X:115845254-115845276 GACCCACTGGAGGAGAGGCACGG - Intergenic
1196446440 X:115848235-115848257 GACCCACTGGAGGAGAGGCACGG - Intergenic
1196447780 X:115854199-115854221 GACCCACTGGAGGAGAGGCACGG - Intergenic
1196449119 X:115860169-115860191 GACCCACTGGAGGAGAGGCACGG - Intergenic
1196449790 X:115863160-115863182 GACCCACTGGAGGAGAGGCACGG - Intergenic
1196450459 X:115866143-115866165 GACCCACTGGAGGAGAGGCACGG - Intergenic
1196451129 X:115869128-115869150 GACCCACTGGAGGAGAGGCACGG - Intergenic
1196451800 X:115872107-115872129 GACCCACTGGAGGAGAGGCACGG - Intergenic
1196452471 X:115875094-115875116 GACCCACTGGAGGAGAGGCACGG - Intergenic
1196453141 X:115878063-115878085 GACCCACTGGAGGAGAGGCACGG - Intergenic
1196453811 X:115881056-115881078 GACCCACTGGAGGAGAGGCACGG - Intergenic
1196454891 X:115886167-115886189 GACCCACTGGAGGAGAGGCACGG - Intergenic
1196455555 X:115889127-115889149 GACCCACTGGAGGAGAGGCACGG - Intergenic
1197854493 X:130900734-130900756 GACTCACTGTAAGGGAGACTCGG - Intronic
1198396080 X:136220543-136220565 GACTGAGGGTCAGAGAGGCTAGG - Intronic