ID: 1128627479

View in Genome Browser
Species Human (GRCh38)
Location 15:69224658-69224680
Sequence GCAGTTTGTACTCAGCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128627479_1128627482 8 Left 1128627479 15:69224658-69224680 CCTGCAAGCTGAGTACAAACTGC 0: 1
1: 0
2: 3
3: 8
4: 131
Right 1128627482 15:69224689-69224711 CACATGCACAGCTGCCTGCCAGG 0: 1
1: 1
2: 3
3: 57
4: 378
1128627479_1128627487 24 Left 1128627479 15:69224658-69224680 CCTGCAAGCTGAGTACAAACTGC 0: 1
1: 0
2: 3
3: 8
4: 131
Right 1128627487 15:69224705-69224727 TGCCAGGGAGCTAGGAGTGGAGG 0: 1
1: 0
2: 0
3: 40
4: 515
1128627479_1128627485 21 Left 1128627479 15:69224658-69224680 CCTGCAAGCTGAGTACAAACTGC 0: 1
1: 0
2: 3
3: 8
4: 131
Right 1128627485 15:69224702-69224724 GCCTGCCAGGGAGCTAGGAGTGG 0: 1
1: 0
2: 0
3: 45
4: 393
1128627479_1128627489 28 Left 1128627479 15:69224658-69224680 CCTGCAAGCTGAGTACAAACTGC 0: 1
1: 0
2: 3
3: 8
4: 131
Right 1128627489 15:69224709-69224731 AGGGAGCTAGGAGTGGAGGATGG 0: 1
1: 0
2: 7
3: 104
4: 1568
1128627479_1128627484 16 Left 1128627479 15:69224658-69224680 CCTGCAAGCTGAGTACAAACTGC 0: 1
1: 0
2: 3
3: 8
4: 131
Right 1128627484 15:69224697-69224719 CAGCTGCCTGCCAGGGAGCTAGG 0: 1
1: 0
2: 16
3: 96
4: 946
1128627479_1128627483 9 Left 1128627479 15:69224658-69224680 CCTGCAAGCTGAGTACAAACTGC 0: 1
1: 0
2: 3
3: 8
4: 131
Right 1128627483 15:69224690-69224712 ACATGCACAGCTGCCTGCCAGGG 0: 4
1: 8
2: 17
3: 54
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128627479 Original CRISPR GCAGTTTGTACTCAGCTTGC AGG (reversed) Intronic
900707289 1:4088765-4088787 GGAGTTTGCACTCAGTTTGAAGG + Intergenic
901213641 1:7540955-7540977 GCAGGTTGTAAGCAACTTGCTGG - Intronic
904315981 1:29663773-29663795 GTAGGTTGTACACAGCTTGCAGG - Intergenic
906096452 1:43227447-43227469 GCAGTGTGTACTCAGCCAACAGG + Intronic
906768770 1:48463131-48463153 GCAGCTTGCAGACAGCTTGCAGG + Intronic
907336983 1:53706215-53706237 GCAGTTTGTAGGAAGCTTCCAGG - Intronic
907524451 1:55046094-55046116 GCAGTTTGCACTGAGCAGGCTGG + Intronic
907838274 1:58132071-58132093 GCAGTTTGATCTCAGACTGCTGG + Intronic
908644869 1:66266386-66266408 GCAGCTTGACCTCAGCTTGCTGG + Intronic
909826943 1:80138164-80138186 GCAGTTTGATCTCAGACTGCTGG + Intergenic
912669798 1:111615205-111615227 GCAGTTTGTACTAAATTTGATGG + Intronic
915176441 1:154019504-154019526 AGAGTTTGTACTTAGCCTGCAGG + Intronic
916257254 1:162801726-162801748 GCAGGTTGGACTCAGCATGTTGG + Intronic
916644468 1:166769274-166769296 GCAGTTTGAACCCAGATAGCTGG - Intergenic
1063069514 10:2647000-2647022 GCAGTTAGAATTCACCTTGCAGG + Intergenic
1066723706 10:38367420-38367442 GCAGGTTGGACTCAGCATGTTGG + Intergenic
1068691638 10:59921819-59921841 GCAGCTTGCTCTCAGCTTGTAGG + Intergenic
1072386043 10:94929229-94929251 GCAGCTTATTCACAGCTTGCAGG - Intergenic
1072814850 10:98496496-98496518 GCAGTTTGCATACAGCTTGCAGG - Intronic
1074113838 10:110441176-110441198 GCAGTGTGGACTCAGCTTGGAGG + Intergenic
1077856994 11:6137480-6137502 GCAGCTTGCATGCAGCTTGCAGG + Intergenic
1084643199 11:70438053-70438075 GCAGCTTGCTCTCAGCCTGCTGG + Intergenic
1085356375 11:75841912-75841934 GCAGTTTGGTCTGAGCTTGGTGG + Intronic
1086749625 11:90475268-90475290 ACAGTTTGCTCTCAGCTTCCTGG - Intergenic
1086989557 11:93288051-93288073 GCAGTGAGTAGTCAGCTTCCAGG + Intergenic
1087322907 11:96684768-96684790 GAAGTTTCTGCTCAGCTTACTGG - Intergenic
1088560609 11:111112075-111112097 CTAGCTTGTACTCATCTTGCAGG - Intergenic
1091937390 12:4444732-4444754 GCAGCTTGCAGGCAGCTTGCAGG + Intronic
1094037451 12:26085951-26085973 CCAGTTTGTTCTCAAATTGCTGG + Intergenic
1095804564 12:46304270-46304292 GCAGATTGCACACAGCTTGAGGG + Intergenic
1102088000 12:110159791-110159813 GCAGCATGCACACAGCTTGCTGG - Intronic
1104904811 12:132207508-132207530 TCAGTGTGTGCTGAGCTTGCGGG + Intronic
1110063599 13:71071889-71071911 GCAGCCTGTACACAACTTGCAGG - Intergenic
1112876111 13:104040791-104040813 GCATTTTGTACACTGATTGCAGG + Intergenic
1114801146 14:25777060-25777082 GCAGTTTGATCTCAGACTGCTGG + Intergenic
1115174762 14:30549275-30549297 GCAGCTTGCACACAGCTTGCAGG - Intergenic
1121697550 14:95926100-95926122 GCACTTTCTACTCATCCTGCTGG + Intergenic
1122960321 14:105091167-105091189 AGAGTTTGTCCTCAGCTGGCAGG - Intergenic
1128627479 15:69224658-69224680 GCAGTTTGTACTCAGCTTGCAGG - Intronic
1141733431 16:85837097-85837119 TCAAATTGTACTCAGCTCGCTGG - Intergenic
1141773139 16:86103271-86103293 AGAGTTTGTACACAGATTGCTGG - Intergenic
1142419361 16:89961001-89961023 TCAGTTCGTATTCAGCTTGGTGG - Exonic
1147782530 17:42953955-42953977 GCAGTTTGTAATCAACCTCCAGG + Intronic
1152247765 17:79194294-79194316 GCAGTTTGTACCTAGATTCCTGG - Intronic
1153788548 18:8556582-8556604 GCACTTTGAGCTAAGCTTGCTGG + Intergenic
1153955853 18:10095541-10095563 GCAGTTTGTCTTCAGTTGGCAGG + Intergenic
1158852229 18:61506304-61506326 AAAGTTTGTACTAAGCTGGCAGG - Intronic
1164527677 19:29023745-29023767 GCAGTATTCACTCAGCCTGCAGG + Intergenic
1165320280 19:35080675-35080697 GGTGTTTGCACTCAGCTTGAAGG + Intergenic
1168479075 19:56702318-56702340 GCAGTTTGTACTCAAAAAGCAGG + Intergenic
926280764 2:11443944-11443966 GCAGTTTATACACAGCACGCAGG - Intergenic
932085639 2:68756237-68756259 GCAGCTTGTGCTCAACGTGCAGG + Intronic
934565526 2:95338171-95338193 GCGGTTTGAACTCAGCCTGAAGG - Intronic
938558530 2:132448995-132449017 GCAGTTTGCAAACAGCCTGCAGG - Intronic
938757275 2:134392524-134392546 GAAGTTTGTTCTTAGCTTGGTGG + Intronic
940602092 2:155875356-155875378 GCAGTTTGATCTCAGACTGCTGG - Intergenic
941161134 2:162035719-162035741 TCAGTTTGTACTGAGCCCGCAGG + Intronic
942949528 2:181706708-181706730 GTTGTGTGTACTCAGCATGCAGG - Intergenic
943303406 2:186230717-186230739 GCAGTTTGATCTCAGACTGCTGG - Intergenic
1171049658 20:21843608-21843630 GAAGTTTGCACACAGCTTGTTGG + Intergenic
1171075110 20:22115024-22115046 GCAGTTTGATCTCAGACTGCTGG - Intergenic
1171478905 20:25437354-25437376 GTAGCTTGTACACAGGTTGCTGG - Intronic
1172582719 20:36061131-36061153 GCAGTTTGAAGGCAGCCTGCCGG - Intergenic
1173444766 20:43107612-43107634 GCACTTTGTTCTCAGCTTAAAGG + Intronic
1173639451 20:44590384-44590406 GCAATTTGTTCTCAGCTGGAGGG - Intronic
1176174021 20:63709253-63709275 GCAGTTTTGTCTCAGCTTCCTGG + Intronic
1177903184 21:26942839-26942861 GCAGTTTTTACTCTACTTTCAGG + Intronic
1178406528 21:32328654-32328676 GCAGCTAATACTCAGCTGGCTGG + Intronic
1180763691 22:18229219-18229241 GCAGCTTGTACCAAGCTTGTGGG - Intergenic
1180771953 22:18395324-18395346 GCAGCTTGTACCAAGCTTGTGGG + Intergenic
1180796875 22:18610234-18610256 GCTGCTTGTTCTCCGCTTGCAGG + Exonic
1180803332 22:18644937-18644959 GCAGCTTGTACCAAGCTTGTGGG + Intergenic
1181218385 22:21350325-21350347 GCAGCTTGTACCAAGCTTGTGGG - Intergenic
1182370568 22:29807443-29807465 GCTCTTGGTACTCAGCCTGCTGG - Intronic
1183913342 22:41095569-41095591 GCAGTTTGTAATATGTTTGCAGG + Intronic
1203233791 22_KI270731v1_random:136314-136336 GCAGCTTGTACCAAGCTTGTGGG + Intergenic
952460634 3:33521934-33521956 GCAGCTTGCACACAGCTTGTGGG + Intronic
953821815 3:46213510-46213532 GCTGTGTGTACTCGGCTTGGAGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954836502 3:53473686-53473708 ACAGTTTGATCTCAGATTGCTGG + Intergenic
955458316 3:59150330-59150352 GCAGCTAGCACACAGCTTGCAGG - Intergenic
955916256 3:63911883-63911905 GCACTTTGCCCTCGGCTTGCGGG - Intronic
957018534 3:75097601-75097623 GCAGTTTGATCTCAGACTGCTGG + Intergenic
957020939 3:75125468-75125490 GCAGTTTGATCTCAGACTGCTGG + Intergenic
958452477 3:94291120-94291142 GCAGTGTGTACTCACCTTCATGG + Intergenic
958683407 3:97360135-97360157 GCAGCTTGCACACAGCTTGTGGG - Intronic
959809754 3:110603104-110603126 GCAGTTTGCACACAGTTTGTGGG + Intergenic
960083623 3:113567657-113567679 GCAGTTTGTACTGAGCACCCAGG - Exonic
960362525 3:116731244-116731266 GTAGTTTATACTGAGCTTGCAGG + Intronic
962533149 3:136302173-136302195 GCAGTTTGCACACAGCTTGCAGG - Intronic
969585037 4:8086670-8086692 ACAGTTTGTCCACAGCTTCCTGG - Intronic
975615398 4:76241483-76241505 CCAGTTTGCACACAACTTGCTGG - Intronic
976589280 4:86833043-86833065 GCACTTTGTAGTCAGATTCCCGG + Intronic
976698056 4:87939130-87939152 GCAGTTTGTTTTCAAGTTGCAGG - Intergenic
976967149 4:91057151-91057173 GCAGCTTGCACACAGCTTACAGG - Intronic
978060160 4:104327218-104327240 GCAGTTTGATCTCAGACTGCTGG + Intergenic
980787620 4:137575132-137575154 TCATTTTGTACTGAGGTTGCAGG - Intergenic
982947220 4:161639745-161639767 GCAGCTTGCACACAGCTTACAGG + Intronic
983908757 4:173212874-173212896 GGATCTTGTACTCAGCTTGAAGG - Intronic
988466580 5:31497582-31497604 GCAGTTTTTATTCTGCTTTCTGG - Intronic
993142362 5:84050721-84050743 GCAGTTTGATCTCAGGCTGCTGG - Intronic
995239115 5:109865741-109865763 TCAGTCTGAACACAGCTTGCTGG + Intronic
995516383 5:112958329-112958351 GCTGTTTGTACTTGGCTTCCAGG + Intergenic
995970111 5:117958570-117958592 GCAGTTTGCACTCAGTTTGCAGG + Intergenic
998040298 5:138947209-138947231 GCACCTGGTACTCAGCCTGCAGG + Exonic
1000797448 5:165682577-165682599 CCAGCTTGCATTCAGCTTGCTGG - Intergenic
1005982758 6:30849774-30849796 GCAGTCGGCTCTCAGCTTGCAGG - Intergenic
1007997145 6:46320330-46320352 GCACTTTGTACTCTGCTTTGAGG - Intronic
1011740356 6:90353494-90353516 GCATTTTGTGTTCAGCTTGCAGG - Intergenic
1012149983 6:95736427-95736449 GCAGCTTGTGCACAGCTTGCAGG + Intergenic
1017732079 6:157325593-157325615 GCTTATTGCACTCAGCTTGCTGG + Intergenic
1019774374 7:2903782-2903804 GCAGTCAAAACTCAGCTTGCAGG + Intergenic
1022386637 7:29905591-29905613 GCAGCTTGCATACAGCTTGCAGG + Intronic
1022894843 7:34739979-34740001 GCCGTTTGTCTTCAGCTAGCAGG + Intronic
1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG + Intronic
1036129084 8:6091520-6091542 GCAGTTTGATCTCAGACTGCTGG + Intergenic
1036536192 8:9655150-9655172 GCAGTTTGATCTCAGACTGCTGG - Intronic
1038511128 8:28136750-28136772 GGAGTATCTACTCAGCTGGCAGG - Intronic
1038642097 8:29337103-29337125 GCAGTTCGTCTTCAGCTTTCCGG - Exonic
1039090232 8:33820125-33820147 GCAGTCTGTACTAAACTTCCTGG + Intergenic
1039198219 8:35056403-35056425 GCAGATTGAACACAGCTTTCAGG - Intergenic
1040675613 8:49745882-49745904 GCAGCTTGTATACAGCTAGCAGG + Intergenic
1042782900 8:72511230-72511252 GCACTCTGTACTCAGATTGGGGG - Intergenic
1043167549 8:76923061-76923083 GCAGATTGTACACTGCTTGAAGG - Intergenic
1043521737 8:81054053-81054075 CCAGAATGTATTCAGCTTGCAGG + Intronic
1043559635 8:81476937-81476959 GCAGCTTGCAGTCATCTTGCAGG - Intergenic
1044224990 8:89708577-89708599 GCAGTTTGATCTCAGACTGCTGG - Intergenic
1044915041 8:97104028-97104050 GATGATAGTACTCAGCTTGCAGG + Intronic
1044943286 8:97365423-97365445 GCAATCTGCACACAGCTTGCAGG + Intergenic
1052894612 9:33735354-33735376 GCTGTTTGTCTTCAGCTAGCAGG - Intergenic
1057753421 9:97810317-97810339 GGTGTTTGTCCTCTGCTTGCTGG + Intergenic
1058498071 9:105581780-105581802 GCAGTTTGATCTCAGACTGCTGG + Intronic
1058631376 9:106990802-106990824 GCATTTTGTACTCATCATGTAGG - Intronic
1061242028 9:129380180-129380202 GCAGGTTGCATCCAGCTTGCAGG + Intergenic
1061805072 9:133133253-133133275 GCAGTGGGCACTGAGCTTGCTGG + Intronic
1187961114 X:24567429-24567451 ACAGTTTGTAATGAGCTTCCTGG + Intronic
1189960604 X:46321314-46321336 GTAGTTTGTCCTCATCTTGTGGG + Intergenic
1190126479 X:47709964-47709986 GCAGCTTGCACACAACTTGCAGG - Intergenic
1191601958 X:63018273-63018295 GCAGTTTGATCTCAGACTGCTGG - Intergenic
1193486232 X:82087924-82087946 TCAGTTTTTACTCTGCCTGCTGG + Intergenic
1195735864 X:108011805-108011827 GCAGTTTGATCTCAGACTGCTGG - Intergenic
1195832289 X:109072358-109072380 GCAGTTTGATCTCAGACTGCTGG + Intergenic
1202105017 Y:21354808-21354830 GCAGTTTGATCTCAGACTGCTGG - Intergenic