ID: 1128630868

View in Genome Browser
Species Human (GRCh38)
Location 15:69265487-69265509
Sequence TGGTTGGTTAATTTAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128630868 Original CRISPR TGGTTGGTTAATTTAAATTG AGG Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
903695430 1:25202729-25202751 TAGTCCGTTAAGTTAAATTGAGG - Intergenic
905365356 1:37448294-37448316 TGGTTGGTTAAGGTGAACTGTGG - Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
908521949 1:64952635-64952657 TAGTTGCTTCATTTTAATTGAGG - Intronic
909862119 1:80620674-80620696 TGGGTTTTTAATTTGAATTGGGG - Intergenic
911240989 1:95466135-95466157 TAGTTGTTTAATTTTATTTGTGG + Intergenic
912183068 1:107241739-107241761 TGATTGCTTAATTCAATTTGGGG + Intronic
913054528 1:115145280-115145302 TGGTTGGTTGTGGTAAATTGTGG + Intergenic
914883210 1:151563851-151563873 TGTATAGTTAATTTAATTTGAGG + Intronic
917076375 1:171209495-171209517 TTATTGGACAATTTAAATTGTGG + Exonic
917478709 1:175391530-175391552 TGGATTGTGAATTTAAAATGGGG + Intronic
918829861 1:189380868-189380890 TCGTTGGCTACTTTAAATAGTGG + Intergenic
919159255 1:193807099-193807121 AGGTTGGTTACTATACATTGAGG + Intergenic
919535181 1:198778394-198778416 TTGTTGGTTCTTTTAATTTGGGG - Intergenic
920310596 1:205046052-205046074 TGGGTGGTTTGTTTAGATTGGGG - Intronic
921064810 1:211615153-211615175 TGGTTGGTAAATTTAGATATGGG + Intergenic
921324356 1:213976382-213976404 TTTTTTTTTAATTTAAATTGTGG - Intergenic
921972685 1:221167439-221167461 CGTTTGGTTCATTGAAATTGTGG + Intergenic
922112959 1:222580475-222580497 TTATTGATTACTTTAAATTGAGG - Intronic
923912523 1:238464370-238464392 TGGTAGATTAATTCAAATTTTGG - Intergenic
923995896 1:239494090-239494112 AGGCAGGTTAATTCAAATTGAGG + Intronic
1063760789 10:9073038-9073060 TGTTAGGTTAATTTAATTTTAGG - Intergenic
1064766127 10:18673924-18673946 AGCTGGGTAAATTTAAATTGTGG + Intronic
1066494695 10:35931275-35931297 TGTTTGGGCAATTTAAATAGTGG + Intergenic
1066647696 10:37626562-37626584 TGTTTGGGTAATTTAAATACTGG - Intergenic
1068715851 10:60187559-60187581 TACTTGCTTTATTTAAATTGAGG + Intronic
1069810271 10:71154268-71154290 TGGTTGGTTTATTTATTTTTTGG - Intergenic
1073519571 10:104114617-104114639 TGGGTTGTCAGTTTAAATTGAGG - Intergenic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1081474015 11:43406890-43406912 TGGTAGGTTACTTTAATGTGTGG + Intronic
1082867714 11:57914815-57914837 TGGGTGATTAAGTTAAAATGAGG - Intergenic
1086215664 11:84377386-84377408 TGGTTGGTTTGTTTAAATTTGGG - Intronic
1087347005 11:96984022-96984044 TAGTTGGTTAATTCAATTTCTGG + Intergenic
1087794991 11:102446585-102446607 TGGTTGGTTGAACTCAATTGTGG - Intronic
1091094905 11:132811150-132811172 TGATTGGTTAATTAATATTTTGG - Intronic
1092034018 12:5315109-5315131 TGGGAGGCTGATTTAAATTGGGG - Intergenic
1092647946 12:10599763-10599785 TGGTTGGTTAGTTGAGATAGAGG - Intergenic
1092984494 12:13832678-13832700 GGGCTGGTTAAATTAAATTATGG - Intronic
1093725771 12:22506666-22506688 TGTTTCCTTTATTTAAATTGTGG - Intronic
1094203674 12:27818081-27818103 TGCCTAGTTAATTAAAATTGAGG - Intergenic
1094658930 12:32447412-32447434 TGGTTGGTTGACTCAAATAGAGG + Intronic
1095368117 12:41432779-41432801 TGGGTGGATAGTTTAATTTGTGG + Intronic
1095717356 12:45361310-45361332 TGTTTCGTTAATTTAACTTTTGG + Intronic
1095794267 12:46199938-46199960 TGGTTAGTTATTTTGAATTAAGG - Intronic
1096178258 12:49537467-49537489 TGGGTGGGTGATTTCAATTGTGG + Intergenic
1096886569 12:54724946-54724968 TTGTAGGGAAATTTAAATTGGGG - Intergenic
1098562497 12:71890448-71890470 TTTTTGATTAAGTTAAATTGAGG + Intronic
1098651886 12:72981321-72981343 AGATTGGTTTATCTAAATTGAGG + Intergenic
1098813432 12:75125445-75125467 CAGTTGATTAATTTTAATTGTGG - Intronic
1099657479 12:85512002-85512024 TTGGTGGTTTATATAAATTGTGG - Intergenic
1099775174 12:87117760-87117782 TGGTTGTTTATTTTAAACTGAGG + Intergenic
1100183792 12:92114835-92114857 TGGTTAGTTTATGTAAATTAAGG - Intronic
1100391140 12:94147513-94147535 TGGTTGGTGCATTTAACTTGAGG + Intergenic
1100938745 12:99701332-99701354 TTGTTGGTTCATTTTTATTGAGG - Intronic
1101284122 12:103292014-103292036 TGATTGGTTAATGGACATTGGGG - Intronic
1102606649 12:114072921-114072943 TGATTGGCTAATTTAAAGAGTGG - Intergenic
1104534111 12:129602403-129602425 TCACTGGTTTATTTAAATTGTGG + Intronic
1105530521 13:21214984-21215006 GGGGTGGTTAAGTTAAAATGAGG + Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106629269 13:31453448-31453470 TGGTTGTTTGATGTAAATTAAGG - Intergenic
1107129691 13:36882049-36882071 TGGTTCGTTTTTTTAAACTGTGG + Intronic
1109756824 13:66772000-66772022 ATTATGGTTAATTTAAATTGTGG - Intronic
1109850443 13:68056524-68056546 TGTTTGTTTAATTTAAGTTCTGG + Intergenic
1111066499 13:83100591-83100613 TTGTTTGTTGATTTTAATTGAGG - Intergenic
1111089761 13:83428377-83428399 TGAGTGGTTTGTTTAAATTGTGG - Intergenic
1112204355 13:97309362-97309384 GGGGTGGTCAATTTAAAATGAGG + Intronic
1113046007 13:106155766-106155788 TATTAGGTTAATTTAAATTTTGG - Intergenic
1113976180 13:114229169-114229191 ATGTTTGTTAATTAAAATTGAGG - Intergenic
1114788048 14:25623839-25623861 TGGTAGGTATATTTAAATTCAGG - Intergenic
1115849788 14:37582193-37582215 TGGCTGGTTCATTTACATTGTGG - Intergenic
1116529784 14:45955955-45955977 TGGTTGCTTCATTTGAAGTGAGG + Intergenic
1116565168 14:46436258-46436280 TTGTTGTTTAATCTGAATTGTGG - Intergenic
1118127916 14:62929581-62929603 TGGTTGTTCAATTTATAATGAGG + Intronic
1118912120 14:70070179-70070201 TGGTAAGTTAATTTGAAATGTGG - Intronic
1119923345 14:78468232-78468254 TGGCTGGTTGATTTAAACTACGG - Intronic
1120759605 14:88273825-88273847 GCGCTAGTTAATTTAAATTGTGG - Intronic
1121353613 14:93194342-93194364 TGGATGGTTAATTTCAAATAGGG - Intronic
1126236321 15:46389418-46389440 TGTTTGTACAATTTAAATTGTGG + Intergenic
1127521979 15:59752083-59752105 AGGTTGGGTAATTTGATTTGAGG + Intergenic
1128630868 15:69265487-69265509 TGGTTGGTTAATTTAAATTGAGG + Intronic
1131215843 15:90534568-90534590 TGGTTGGTTGGTTTTAATTAGGG + Intronic
1134261149 16:12651930-12651952 TGGTTGTTTAATCTGAATTTTGG + Intergenic
1138721641 16:59089148-59089170 TGGTAGATTAATTCAAATTATGG - Intergenic
1140320284 16:73944470-73944492 TGTTTTGTTAATTTAAAGTATGG + Intergenic
1140823878 16:78688071-78688093 TGGTCTGTGAATTTGAATTGTGG - Intronic
1140826674 16:78713516-78713538 AGGATGGTTAAGTTAAAATGAGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144356553 17:14452117-14452139 TCGTTGTTTATTTTAGATTGTGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1145194301 17:20874984-20875006 TGGTCAGTTTATGTAAATTGTGG + Intronic
1145297736 17:21606112-21606134 TGGTCGGTCTATCTAAATTGTGG - Intergenic
1145768356 17:27475002-27475024 TGGTGGTATAATTTAAAGTGAGG + Intronic
1146097118 17:29941286-29941308 TGGTTTATTCATTTATATTGAGG - Intronic
1149714649 17:58776594-58776616 TATTTGGTGAATTTAAAATGAGG - Intronic
1149958693 17:61082527-61082549 TAGTTAGTCAATTTATATTGGGG - Intronic
1150153210 17:62828140-62828162 TTGTTGTTTTAATTAAATTGGGG - Intergenic
1150499099 17:65632768-65632790 TGGTTGGTCAATTCAAAGTGGGG - Intronic
1154935240 18:21048102-21048124 TGATTGGTTATGTTCAATTGTGG - Intronic
1155069075 18:22297349-22297371 TTGATGGGTAATTTAGATTGTGG - Intergenic
1156074078 18:33251339-33251361 AGGATGATTAGTTTAAATTGAGG + Intronic
1156376017 18:36515943-36515965 TGGTTGGTTACATCAAAATGTGG - Intronic
1156382986 18:36580805-36580827 TGATTTCTTAATTTGAATTGGGG - Intronic
1157790511 18:50527107-50527129 TGGCTGGTTTCTTTAACTTGAGG - Intergenic
1160468357 18:79102892-79102914 TGGTTTGGTATTTTAAATTTTGG + Intronic
1160543241 18:79637280-79637302 TGGTTTGTTCATTTAGATTTCGG - Intergenic
1161409427 19:4108670-4108692 TTCTTGGTGAATTTAAAATGGGG - Intronic
1166669063 19:44698878-44698900 TGGTTTGCTACTTTAAATTGGGG - Intergenic
927886580 2:26722214-26722236 TGCTTGGCTCAATTAAATTGGGG - Intronic
928797759 2:35043539-35043561 TGTTTTCTTAATTTAAAGTGGGG + Intergenic
930426182 2:51216005-51216027 TGGTTGGTTGATATCAATGGTGG + Intergenic
931730043 2:65145230-65145252 TGTTTTTTTAATTTAAATTTAGG - Intergenic
931737273 2:65207732-65207754 TAGTTGGTTTATTCAAATTCAGG + Intergenic
933356557 2:81217498-81217520 TTGTTGGTTTATTTTATTTGAGG + Intergenic
933459146 2:82557484-82557506 TGGTGAGTTTATTGAAATTGAGG + Intergenic
937604699 2:123784593-123784615 TGGATGATTGATTTAAACTGTGG - Intergenic
938309728 2:130281224-130281246 TGGTTGATTAATGCCAATTGTGG - Intergenic
938445191 2:131371144-131371166 TGGTTGATTAATGCCAATTGTGG + Intergenic
940758620 2:157712193-157712215 TGGTTGTTCAATTCAAATTTTGG + Intergenic
941287796 2:163635790-163635812 TGATGGGTTATTTTATATTGAGG + Intronic
941735345 2:168968908-168968930 TGGTTGGTTAATTTAGATTGAGG + Intronic
942128613 2:172853859-172853881 TTTTTGGTTTAATTAAATTGTGG + Intronic
943249703 2:185502607-185502629 TGGTTGGTGAAATTACATTTTGG - Intergenic
943830936 2:192460842-192460864 GGGTTGGTAAAATTAAAATGGGG - Intergenic
944246147 2:197532372-197532394 TGGTTAAATAATTAAAATTGGGG + Intronic
944832216 2:203544218-203544240 TGGTTGGTTGAATTCATTTGTGG - Intergenic
944839730 2:203613523-203613545 TGTTTTGTTTTTTTAAATTGTGG - Intergenic
945728370 2:213502035-213502057 TGATTTTTTAATTTAAATAGTGG + Intronic
948068196 2:235098006-235098028 TCTTTGGTTAATTTAATTTATGG - Intergenic
948422546 2:237869255-237869277 TGCTTTTTTAATTTTAATTGCGG + Intronic
1169963189 20:11185861-11185883 TGGTTGGCTAGTTTAACTTTGGG + Intergenic
1171562844 20:26142604-26142626 TGGTCGGTCTATCTAAATTGTGG + Intergenic
1172545474 20:35757571-35757593 TGGATGGATAATTTTAACTGAGG - Intergenic
1172827601 20:37803724-37803746 TGGATGGTTATTTTAAAGTGTGG + Intronic
1173927778 20:46793525-46793547 TAATTGTTTAATTTCAATTGTGG + Intergenic
1174902615 20:54516292-54516314 GGGTTGTTTTATTCAAATTGGGG + Intronic
1177468236 21:21518562-21518584 TAGTTGTTTTATTTAAATAGAGG + Intronic
1178666355 21:34550417-34550439 TGGGTGACTAAGTTAAATTGAGG + Intronic
1178844613 21:36164154-36164176 TGGCTGTTTTATTTAAAGTGTGG - Intronic
1182709611 22:32312311-32312333 TGGTTGGTTGGTTTTTATTGGGG - Intergenic
1184382829 22:44156726-44156748 TCTTTAATTAATTTAAATTGTGG - Intronic
1184397169 22:44249174-44249196 TGGTTGGTTGGTTTTTATTGGGG - Exonic
1185020134 22:48369697-48369719 TGCTTGGATAATTTAGAATGCGG - Intergenic
949574614 3:5326765-5326787 TGTTTGTTTATTTTAAGTTGTGG - Intergenic
951531016 3:23698168-23698190 AGGGTGATTAATTTAAAATGAGG + Intergenic
956644179 3:71440261-71440283 TTGTTTGTTATTTTTAATTGTGG - Intronic
958687667 3:97420790-97420812 TGGTTGGTTACATTTAATTTAGG - Intronic
959192773 3:103136577-103136599 TCACTGGTGAATTTAAATTGAGG + Intergenic
959475182 3:106802239-106802261 TAGGTGATTAAGTTAAATTGAGG - Intergenic
960038139 3:113122262-113122284 TTGTTGTATAATTTACATTGTGG + Intergenic
960094276 3:113673559-113673581 TGGTTTCTAAATTTATATTGAGG - Intronic
960453303 3:117837845-117837867 TGGTTGATTAATCTAAAAAGGGG + Intergenic
961061877 3:123835507-123835529 AGGATGGTTAATTAAACTTGAGG - Intronic
962280067 3:134045202-134045224 TGGTTGGTTAATTTTGAGTAGGG - Intronic
962990226 3:140571374-140571396 TATTTGGTTAATTTAAATGTGGG - Exonic
964582654 3:158257617-158257639 AGTTTGGTTAATTTACATTCAGG + Intronic
964877076 3:161379493-161379515 TGGTTGGATCATCAAAATTGCGG - Intergenic
965972458 3:174577712-174577734 TGATTGGGTAATCTAAATTGTGG - Intronic
970726617 4:19053348-19053370 TGGTTAGTTGATTTAAATTCAGG + Intergenic
971827086 4:31638090-31638112 TGGCTGGTTAATTTTATTTTGGG + Intergenic
976012028 4:80501035-80501057 TGATTGTTTAATTGAAAGTGGGG + Intronic
976108420 4:81644256-81644278 TGGGTGATTAAGTTAAAATGAGG + Intronic
977373598 4:96171309-96171331 AAGTTGGTTCATTTAAACTGTGG + Intergenic
978531481 4:109719210-109719232 TGGTTGGTTAATGGTTATTGAGG - Intronic
979017868 4:115457967-115457989 GGGGTGGTTAAATTAAAATGAGG - Intergenic
979827203 4:125253343-125253365 TCATTGGTTAATTTGATTTGGGG + Intergenic
980501247 4:133656946-133656968 TGTTTGCTTAATTTTCATTGTGG - Intergenic
980607165 4:135107920-135107942 TATTTGGTTGATTTACATTGAGG + Intergenic
980690565 4:136291094-136291116 TGGCTTTTAAATTTAAATTGAGG + Intergenic
983261239 4:165459477-165459499 TGGATGGTTACATGAAATTGTGG + Intronic
985092584 4:186379559-186379581 TGATTGGTTTATTTAATTTTGGG - Intergenic
985213638 4:187623995-187624017 AGGTTGGATATTTTATATTGAGG - Intergenic
985899526 5:2777848-2777870 TGGGTGATTAAGTTAAAATGAGG + Intergenic
989540126 5:42608675-42608697 TTTTTGGTTAGTTTAATTTGAGG - Intronic
989776530 5:45214864-45214886 TGTTAGGTGAATTTACATTGAGG - Intergenic
991485167 5:67127813-67127835 TGGTTGTTTAATTTAAAAGTTGG + Intronic
992824480 5:80535009-80535031 TAGGTAGTTAATTTTAATTGTGG - Intronic
993628895 5:90259815-90259837 TAATTAGTTGATTTAAATTGGGG + Intergenic
993641170 5:90408416-90408438 TGGTTTGTTAATATCAATGGAGG - Intronic
995541402 5:113189825-113189847 TGGCTGCTTAATTAAGATTGTGG - Intronic
999643198 5:153692305-153692327 TGGTTGATTGATCTAGATTGAGG + Intronic
1000596998 5:163227196-163227218 AATTTGTTTAATTTAAATTGAGG + Intergenic
1003400925 6:5790263-5790285 GGGGTGGTTAAGTTAAAATGAGG - Intergenic
1003650436 6:7954630-7954652 TGGTTGGTTGATTTAGACAGGGG - Intronic
1003664219 6:8094650-8094672 GGGATAGATAATTTAAATTGTGG + Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1007379498 6:41478512-41478534 TGGGTGGTTAATTTTAAGTTGGG - Intergenic
1008374393 6:50775197-50775219 TGGCTGGTTAAGTTAAATGATGG - Intergenic
1008452157 6:51665456-51665478 TGGTGGGATTATTTAATTTGTGG - Intronic
1010389656 6:75322125-75322147 TGCTTGTTTAATGTAAAATGAGG - Intronic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1014119493 6:117707023-117707045 TGGTTGCATAATTTGATTTGAGG + Exonic
1014130351 6:117823889-117823911 TCATTGGTAAATTTAACTTGTGG + Intergenic
1014595113 6:123326694-123326716 TTCTTGGTTAATTTATAATGTGG - Intronic
1014643374 6:123942775-123942797 AGGTTTGTTAATTTAAATCATGG - Intronic
1015650417 6:135451357-135451379 TGTTTGGTGAATATATATTGAGG - Intronic
1015748976 6:136540987-136541009 TGGTGGGTTCATTTAAATATGGG - Intronic
1016637526 6:146311034-146311056 TAGTTGGTTTAATTAAATTATGG + Intronic
1017687384 6:156927143-156927165 TTATTGTTTAATTTACATTGTGG + Intronic
1020804339 7:12769895-12769917 TGCTTGGTTCATTTGAATTCAGG - Intergenic
1020900858 7:14001890-14001912 TGGTTTTTAAATTTAAGTTGTGG + Intergenic
1021535892 7:21704099-21704121 GGCTTGATTAATTTAAATTCTGG + Intronic
1024336272 7:48209545-48209567 TTGTTGGTTTATTCAAATTTTGG + Intronic
1024405552 7:48975615-48975637 TGATTGTATAATTTGAATTGAGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1027145605 7:75692061-75692083 TGGTTGGTTGGTTGTAATTGAGG - Intronic
1027398285 7:77780968-77780990 TGGTTGATGACTTTCAATTGGGG + Exonic
1028730139 7:94137678-94137700 TAACTGGTTCATTTAAATTGTGG + Intergenic
1030164844 7:106543874-106543896 TGGTTTGTAAAATAAAATTGGGG + Intergenic
1030656295 7:112172047-112172069 TAGGTGGTTAAGTTAAAATGAGG - Intronic
1031421276 7:121554326-121554348 AGGGTTGTTAAATTAAATTGAGG - Intergenic
1031438776 7:121766098-121766120 TGGTTTGTTAATTTAGCTTTTGG - Intergenic
1034352080 7:150422920-150422942 TGCTTGCTTAATTTATATAGGGG + Intergenic
1034374943 7:150633890-150633912 TAGATGGTTAATTTCAATTATGG - Intergenic
1035443659 7:158924502-158924524 TGGTTGGGGAATTTAAAAAGTGG - Intronic
1035624074 8:1058680-1058702 TGGTTGGTAAATTAGAGTTGTGG + Intergenic
1035687255 8:1534156-1534178 TGATTGGTTGGTTTAAATTAAGG + Intronic
1036441314 8:8783428-8783450 TGGTTTGTGAATTTTAATTGTGG - Exonic
1036716990 8:11134718-11134740 TGGTAGGTTAATTTCTTTTGGGG - Intronic
1038375206 8:27033164-27033186 GGGTAGGTTAATATGAATTGAGG + Intergenic
1038935691 8:32248751-32248773 TGGTTGGTAAATCTAAGTTTAGG + Intronic
1039048492 8:33472205-33472227 TGGATTGTTAATTTAGTTTGTGG - Intronic
1039099187 8:33922623-33922645 TGGTTGGTTTATATGAAGTGTGG - Intergenic
1040985581 8:53290678-53290700 TGATTGGTTAATGTAAGTGGGGG + Intergenic
1041819572 8:62015455-62015477 TGGTTGGTAACTTGCAATTGTGG - Intergenic
1041966909 8:63688751-63688773 TGGTTGGTTGATTTAAAGCAGGG + Intergenic
1042013015 8:64270807-64270829 TGTTAGGTTAATTTATATTTTGG - Intergenic
1043665803 8:82811421-82811443 CTGTTGCTTAATTTAAAATGGGG + Intergenic
1044603383 8:94027604-94027626 AGGTTGGTGCAATTAAATTGCGG + Intergenic
1045445423 8:102257527-102257549 TGGTTGGTCATTTTAATTTTGGG - Intronic
1046891433 8:119426054-119426076 TGGGTGGCTAATTTAGCTTGAGG + Intergenic
1046941136 8:119932772-119932794 TGGTGGGGTACTTTAAATAGGGG + Intronic
1047643758 8:126848332-126848354 TGGTTAGTCAATTAAAACTGAGG + Intergenic
1052245434 9:26328603-26328625 GGGGTGGTTAATTCAAATTTGGG - Intergenic
1055386093 9:75763537-75763559 TAGTTAGTTAATTCAAAGTGAGG + Intergenic
1055624524 9:78161516-78161538 TGGTTTGTTAATGTAAATGGAGG + Intergenic
1056016812 9:82397803-82397825 TGATTGGTTAATTTACAATGAGG - Intergenic
1056438505 9:86596758-86596780 TGGTTGGTTAAATTTAAAAGCGG + Intergenic
1057424521 9:94937446-94937468 GGGGTGGTTAAATTAAAATGAGG - Intronic
1058268864 9:102943574-102943596 TGGATGGCTAATTAGAATTGAGG + Intergenic
1058927965 9:109687202-109687224 TAGCTGGTGACTTTAAATTGAGG - Intronic
1060463651 9:123882879-123882901 TGTTTTGTTTGTTTAAATTGTGG - Intronic
1060558167 9:124520724-124520746 TAGTTGGTTAAATAAAATTCAGG + Exonic
1060704708 9:125787729-125787751 TGTTTGGTTTAATTAAATTGAGG + Intronic
1186461036 X:9748816-9748838 TGGTTGGTTGTTTTCCATTGAGG + Intronic
1186809396 X:13173255-13173277 TGGTTTGTAAATTTAACCTGAGG - Intergenic
1188354494 X:29174699-29174721 AGGTTGATTTATTTAAATTGCGG + Intronic
1188992997 X:36846936-36846958 TTATTGGTTAATTTATACTGTGG - Intergenic
1190099621 X:47512572-47512594 TGGTTGCGTAATTTGATTTGAGG - Intergenic
1193474597 X:81947783-81947805 TGGTTAGTTATGGTAAATTGTGG - Intergenic
1193711783 X:84889467-84889489 TGGTTGGTTATCATAATTTGGGG - Intergenic
1194146432 X:90270985-90271007 TTGTTGGTTAAATTGAATTTTGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195375258 X:104220553-104220575 TGGTTGGTTCATGTAAACTCTGG + Intergenic
1196122225 X:112063556-112063578 TGTTTTGTTAATTTAAATAAAGG + Intronic
1197006991 X:121513748-121513770 TAGTAGGTTCATTTAACTTGTGG - Intergenic
1197519694 X:127482205-127482227 TGGTTATTTAATTTTATTTGTGG + Intergenic
1198850912 X:140964749-140964771 TGGCTGATGAATTTAAATGGGGG + Intergenic
1198892792 X:141417875-141417897 TGGTTGGTTTATTTCACTTAGGG - Intergenic
1199278172 X:145970613-145970635 TGATTGGCTAATTTAAAGAGAGG - Intergenic
1199753683 X:150845001-150845023 AGGTTGCTTAATTTAAATGCAGG + Intronic
1200181613 X:154154467-154154489 GGGTTTGTTTTTTTAAATTGAGG - Intronic
1200187261 X:154191581-154191603 GGGTTTGTTTTTTTAAATTGAGG - Intergenic
1200192910 X:154228721-154228743 GGGTTTGTTTTTTTAAATTGAGG - Intronic
1200198665 X:154266525-154266547 GGGTTTGTTTTTTTAAATTGAGG - Intronic
1200492169 Y:3840163-3840185 TTGTTGGTTAAATTGAATTTTGG - Intergenic
1201738170 Y:17293490-17293512 TGGTTGCTTAGTTAAAAATGAGG - Intergenic
1202047305 Y:20747878-20747900 TGGTTGGTTGTTTTCCATTGAGG + Intergenic