ID: 1128632391

View in Genome Browser
Species Human (GRCh38)
Location 15:69280085-69280107
Sequence ACCCAGCTGACACTAATGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128632389_1128632391 -4 Left 1128632389 15:69280066-69280088 CCAGCTGATTCCATTGACTACCC No data
Right 1128632391 15:69280085-69280107 ACCCAGCTGACACTAATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128632391 Original CRISPR ACCCAGCTGACACTAATGTT TGG Intergenic
No off target data available for this crispr