ID: 1128635379

View in Genome Browser
Species Human (GRCh38)
Location 15:69299164-69299186
Sequence GAGCCTGGGTGGCCGCTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 162}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128635361_1128635379 24 Left 1128635361 15:69299117-69299139 CCGCCCTCCGCGGCAGCCCCAGC 0: 1
1: 0
2: 3
3: 69
4: 732
Right 1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 162
1128635368_1128635379 6 Left 1128635368 15:69299135-69299157 CCAGCCGCCCTGCGCCCGTGGAG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 162
1128635364_1128635379 17 Left 1128635364 15:69299124-69299146 CCGCGGCAGCCCCAGCCGCCCTG 0: 1
1: 0
2: 5
3: 67
4: 665
Right 1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 162
1128635363_1128635379 20 Left 1128635363 15:69299121-69299143 CCTCCGCGGCAGCCCCAGCCGCC 0: 1
1: 0
2: 13
3: 191
4: 2302
Right 1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 162
1128635369_1128635379 2 Left 1128635369 15:69299139-69299161 CCGCCCTGCGCCCGTGGAGCCCG 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 162
1128635371_1128635379 -2 Left 1128635371 15:69299143-69299165 CCTGCGCCCGTGGAGCCCGTTGA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 162
1128635370_1128635379 -1 Left 1128635370 15:69299142-69299164 CCCTGCGCCCGTGGAGCCCGTTG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 162
1128635374_1128635379 -9 Left 1128635374 15:69299150-69299172 CCGTGGAGCCCGTTGAGCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 162
1128635367_1128635379 7 Left 1128635367 15:69299134-69299156 CCCAGCCGCCCTGCGCCCGTGGA 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 162
1128635365_1128635379 8 Left 1128635365 15:69299133-69299155 CCCCAGCCGCCCTGCGCCCGTGG 0: 1
1: 0
2: 1
3: 18
4: 229
Right 1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 162
1128635362_1128635379 21 Left 1128635362 15:69299120-69299142 CCCTCCGCGGCAGCCCCAGCCGC 0: 1
1: 0
2: 2
3: 34
4: 399
Right 1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 162
1128635372_1128635379 -8 Left 1128635372 15:69299149-69299171 CCCGTGGAGCCCGTTGAGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 162
1128635360_1128635379 25 Left 1128635360 15:69299116-69299138 CCCGCCCTCCGCGGCAGCCCCAG 0: 1
1: 0
2: 5
3: 62
4: 546
Right 1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128635379 Original CRISPR GAGCCTGGGTGGCCGCTCCG AGG Intronic
900129200 1:1080464-1080486 GGGCCTGGGGGGCTGCTCAGAGG + Intergenic
900237924 1:1601267-1601289 GAGGCTGGGTGGTGACTCCGTGG - Intergenic
900785710 1:4648836-4648858 GAACCTGGTTGGCTGCTCCCAGG + Intergenic
902166100 1:14572732-14572754 GGGAGTGGGGGGCCGCTCCGCGG - Intergenic
904756253 1:32770389-32770411 GAGGATGGGTGGCGGCTGCGGGG - Exonic
906104819 1:43285501-43285523 GAGCCTGGGTACCCCCTCCCCGG + Exonic
910981109 1:92961143-92961165 GAGCCCGGCTGGCCGCGGCGCGG + Intronic
912473775 1:109923367-109923389 GCTCCTGGGTGGCCGCTGCTTGG - Exonic
916444167 1:164856566-164856588 GAGCCTGGGTGTGTGCTCCTGGG - Intronic
917854548 1:179090068-179090090 CAGCCTGGGTGGACTGTCCGAGG + Intronic
919739065 1:200971772-200971794 TAGCCTCTGTGGCAGCTCCGAGG + Intronic
923490403 1:234478860-234478882 GAGCCTGCGCGGACGCCCCGCGG - Exonic
1070288497 10:75100156-75100178 GAGCCTGGCTGCCTGCTCCCTGG - Intronic
1070328972 10:75404747-75404769 GAGCGTGTGTGGCCACACCGGGG - Intergenic
1073290168 10:102409416-102409438 CAGCGTGGGTGGCAGCTCCAGGG + Intronic
1076644842 10:131946005-131946027 GAGCCTGGGTGTCTCCTCAGAGG + Intronic
1077205026 11:1337766-1337788 GGGCCTGGGGGGCGCCTCCGGGG + Intergenic
1077229842 11:1453836-1453858 GCGCCTGGGTGGCTGTTCAGAGG - Intronic
1088598472 11:111456601-111456623 GAGCCTGCGTGGCCGCTGGCTGG - Exonic
1088897567 11:114089925-114089947 GAGCCTGGCTGGCTGCCCCAGGG - Intronic
1089785578 11:120904684-120904706 GATCCTGAGTGGCTGCTCAGTGG - Intronic
1100565539 12:95790590-95790612 GAGCCCGCAGGGCCGCTCCGCGG - Exonic
1101879439 12:108616515-108616537 GAGCCAGGGTGGCCGCATGGAGG - Intergenic
1102475387 12:113185343-113185365 GGGCCTGGGAGGCCGCGCCTCGG + Exonic
1104437127 12:128765393-128765415 GAGTCTGAGTGGCCTGTCCGGGG - Intergenic
1104761292 12:131298872-131298894 GAGGCTCGGTGGCTGCTGCGGGG + Intergenic
1104769911 12:131354931-131354953 CAGCCTGGGAGGCCCCTCGGGGG - Intergenic
1104818483 12:131661920-131661942 GAGGCTCGGTGGCTGCTGCGGGG - Intergenic
1106070490 13:26406747-26406769 GAGCCTGGATGGCAGCACCCAGG - Intergenic
1113766093 13:112881967-112881989 GAGGATGGGTGGGGGCTCCGTGG - Exonic
1118779520 14:68997826-68997848 GACCGTGGGTGGCCTCTCAGAGG - Intergenic
1118935526 14:70284519-70284541 GAGCCTGGGTGGCGGCCACCAGG - Intergenic
1120163417 14:81169763-81169785 GTGTCTGTGTGGCCGCTCTGTGG - Intergenic
1122588168 14:102825584-102825606 TAGCCTGAGTGGGCTCTCCGTGG - Intronic
1122996620 14:105268691-105268713 GATCCTGGGGGGCCTCTCCTGGG + Intronic
1124578418 15:30929306-30929328 GGGCCTGGGTGGCAGCCACGTGG + Exonic
1124641357 15:31398468-31398490 GAGCCTGGGTGTAGGCTGCGGGG - Intronic
1127867577 15:63044186-63044208 TTGCCTGCGTGGCCACTCCGGGG + Intronic
1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG + Intronic
1130352589 15:83105614-83105636 GAGCCTGGCTGGGAGCTCAGAGG + Intergenic
1132589656 16:721115-721137 GAGCCTGCGCGGTCGGTCCGTGG - Exonic
1132606747 16:796857-796879 GAGCCTGGGTGGGCTCACCTGGG - Exonic
1132815868 16:1826376-1826398 GAGCCTGGGGCGCGGCTCTGAGG - Intronic
1133739322 16:8639792-8639814 AAGCCTGGGGGGCTGCTCGGAGG - Intronic
1137426560 16:48385351-48385373 GAGCCGGGGCGGCCGTTGCGGGG - Intronic
1138417994 16:56882287-56882309 GAGCCTTGGTGGCCTGTCTGGGG + Intronic
1139433156 16:66921952-66921974 GTGCCCGGCTGGCAGCTCCGAGG + Exonic
1139572683 16:67823133-67823155 GAGCCTGGGGGGCAGCTCTCTGG - Intronic
1141621882 16:85240657-85240679 GAGCCTGGGTGCGCCCTGCGAGG + Intergenic
1143178025 17:4967751-4967773 GAGGCTGGGTGGCTTCTCCATGG + Exonic
1144684268 17:17215853-17215875 GAGCCTGGGGGGCTGATCCCTGG + Intronic
1146438918 17:32876906-32876928 GGGCCTCCGGGGCCGCTCCGTGG + Exonic
1146653655 17:34622599-34622621 GAGACTGGGTGGCCACTGAGGGG - Intronic
1147721588 17:42543036-42543058 GAGGCTGTGTGGCTGCTCCAAGG + Exonic
1152387201 17:79981714-79981736 GAGCCGAGGGAGCCGCTCCGAGG - Intronic
1152960852 18:79500-79522 GAGCCTCAGGGGCAGCTCCGGGG - Intergenic
1152960863 18:79534-79556 GAGCCTCAGGGGCAGCTCCGGGG - Intergenic
1155221642 18:23690301-23690323 AAGCCTGGCGGGACGCTCCGTGG - Intronic
1160265751 18:77339796-77339818 GAGCCTGGATCGCAGCTCCCTGG + Intergenic
1160408113 18:78656636-78656658 GAGGCTGGGTGGGCGCTGCATGG - Intergenic
1160886980 19:1354758-1354780 GGGCATGTGTGGCCGCTCCCGGG - Intronic
1160895914 19:1401685-1401707 GAGCCTCGGTGCCCCCTCTGCGG + Intergenic
1161096732 19:2396463-2396485 GGGCCTGGGTGGCAGCTCAGCGG + Intronic
1163847653 19:19646548-19646570 GAGCCTGGATGGCGGAGCCGGGG - Intronic
1165247360 19:34505147-34505169 CAGCCTGGGTGGGGGCTCAGAGG + Exonic
1165875117 19:39001138-39001160 GAGCTGGGGTGGCCTGTCCGAGG + Intronic
1167211165 19:48134981-48135003 GAGCCCTCGTGGCCGCTCCACGG + Intronic
1167418783 19:49390740-49390762 GACCCTTGGTGGCTGCTCTGAGG + Intronic
1168280839 19:55304704-55304726 GAGCCTGGGGGGCCGGGCAGGGG - Exonic
1168288407 19:55345698-55345720 GAGCCTGTGGGGCAGCTCCTGGG + Intronic
926054297 2:9765386-9765408 GAGGCTGGGTGGCCGCACGTTGG + Intergenic
926088663 2:10036129-10036151 CAGCCTGGGTGGCGGCTCCTGGG + Intergenic
932475317 2:72002420-72002442 GAGCCAGCGTGGCCCCTCCCCGG + Intergenic
933560106 2:83877442-83877464 GAGACACAGTGGCCGCTCCGAGG + Intergenic
934527228 2:95059431-95059453 GAGCCTGGGAGGCGGGGCCGAGG - Intergenic
942213286 2:173693054-173693076 GAGCCTGGTTGGGGGCTCAGGGG - Intergenic
946190684 2:218006274-218006296 GAGCCTGGCAGGCCCCTCCCTGG + Intergenic
947794540 2:232885704-232885726 GTGCCTGGGTGGCCACCCAGGGG - Intronic
948890100 2:240903355-240903377 GAGCCTGGCTGGGCCCCCCGGGG - Intergenic
948973106 2:241444553-241444575 GGGCAGGGGTGGCCGCTCCCTGG + Intronic
1168789835 20:568540-568562 GAGCCTGGGGCCCCGCTCAGGGG - Intergenic
1171175514 20:23048886-23048908 GCGCCTGGAAGTCCGCTCCGCGG + Exonic
1171249940 20:23639143-23639165 GAGCCTGGGTGACCGAGCCATGG + Intergenic
1171512424 20:25696428-25696450 GTGCCAGGGTCGCCGCTCCTCGG - Intronic
1172446582 20:34996541-34996563 GAGACTGGGTGGCGGGGCCGGGG + Intronic
1174343797 20:49915173-49915195 GAGCCTGCGAGGCAGCTCCCGGG + Intronic
1174767444 20:53267274-53267296 GAGCCTGTGTCGAGGCTCCGAGG + Intronic
1175345289 20:58268637-58268659 GTTCCTGGGTGGCGGCTCTGGGG + Intergenic
1175917068 20:62430962-62430984 GAGGATGGGTGGCTGCTCGGGGG - Intergenic
1176047833 20:63101906-63101928 GAGCCTGAGTGTCCCCTGCGTGG + Intergenic
1176047851 20:63101966-63101988 GAGTCTGGGCTGCTGCTCCGCGG + Intergenic
1179515516 21:41903769-41903791 GAGCCTGGGGGCCGGCTCCATGG + Intronic
1179727538 21:43348742-43348764 GAGCCTGGCTGGGTCCTCCGGGG - Intergenic
1179881393 21:44294591-44294613 GACCCTGGGTGCCAGCTTCGAGG + Intronic
1182091286 22:27596653-27596675 GGGCCTGGGAGGCCGCTTCGTGG - Intergenic
1182296950 22:29315542-29315564 GCGCCTGGGTTGGCGCTGCGGGG - Exonic
1182669540 22:31984219-31984241 GAGGCTGGCTGGCCTCTCTGAGG + Intergenic
1183698109 22:39434602-39434624 GAGCCTGGGCGGCCGCGTCAGGG + Intronic
1183735401 22:39642221-39642243 GAGGGTGGGTGGCCGCTCAGGGG + Intronic
1184101779 22:42344632-42344654 GGGACTGGGTGGCCACTCGGGGG - Intergenic
1184478940 22:44736188-44736210 GGGCCTCGCTGGCCGCTGCGTGG - Intronic
1184690250 22:46114196-46114218 GGGCCTTGGTGGCTGCCCCGTGG - Intergenic
1184752052 22:46492128-46492150 GAGCCTGGGAAGCAGCCCCGAGG - Intronic
1184874875 22:47268019-47268041 GAGCCTCGCTGGCCTCTCAGGGG - Intergenic
1185079374 22:48701320-48701342 GAAGCTGGGTGGCAGCTCCCAGG + Intronic
1185376322 22:50484134-50484156 GCGCCTGGGTGGGCGCTTCCAGG - Exonic
950659470 3:14457972-14457994 GAGCCTGGGTGGTCGATTCCAGG - Exonic
950689385 3:14643583-14643605 GTGCCTGGGTGGAGGCTCCTTGG + Intergenic
952316573 3:32237999-32238021 GAGCCTGGGTGACGGCGCCTGGG - Intergenic
954123706 3:48516550-48516572 GAGCCTGGGGGACAGCTTCGGGG - Intergenic
954778867 3:53045328-53045350 GAGCCCGGGGGGCGGGTCCGCGG + Intronic
957039705 3:75327732-75327754 AAGTCTGGGTGGGAGCTCCGAGG - Intergenic
958425415 3:93973722-93973744 GGTCCTGGGTGGGCGCTGCGGGG - Exonic
962575374 3:136751641-136751663 GGGCCTGGGGGGTCGCTCGGCGG - Intronic
963085193 3:141429726-141429748 GAGATGGGGTGGCCCCTCCGAGG + Intronic
968649349 4:1754253-1754275 GAGCCTGGCTGGGCTCTCCCGGG - Intergenic
969364787 4:6688021-6688043 CTGCCTGGGTAGCCGCTCCATGG + Intergenic
969542985 4:7805330-7805352 GAGCCTGGGTAGCCATTCCCAGG - Intronic
969933962 4:10662997-10663019 GAGCCTGGGTGGCCAGTGCAGGG + Intronic
973821347 4:54664400-54664422 AAGCCTGGGGGGCCACTCCTGGG - Intronic
980349149 4:131665164-131665186 GAGACAGGGTGGCCTCTCTGGGG + Intergenic
984840652 4:184064534-184064556 GAGCATGGATGGCCCCTCTGCGG + Intergenic
986165565 5:5269187-5269209 TGGCCTGGGTGGGGGCTCCGGGG - Intronic
990581803 5:57173507-57173529 GAGCCTGCGCGGCCGCTTCCCGG + Intergenic
993226367 5:85170125-85170147 GTGCCTGAGTGGCTGCTCTGTGG + Intergenic
994092021 5:95818083-95818105 GAGGCTGGGGGGCAGCTCCAGGG - Intronic
1001424081 5:171612169-171612191 GAGCCTGGGCAGCCGCTGGGAGG + Intergenic
1002382889 5:178842841-178842863 GAGCCTGGCTGGCTGCTTCAGGG - Intergenic
1003869444 6:10390432-10390454 GAGCCTGGAGGGCCGCTCCTGGG - Intergenic
1013507618 6:110815419-110815441 GAACCTGGTGGGCCGCGCCGTGG + Intronic
1015750001 6:136550134-136550156 GAGCCGGGCTGGCCGAGCCGCGG + Intronic
1018903404 6:168062329-168062351 GACCCTGGGTGACAGCTCTGGGG + Intronic
1019594871 7:1853821-1853843 CAGCCTGGGTGGCCGAGCAGGGG + Intronic
1020086995 7:5315900-5315922 GAGCCTGGGTGGGCGGCCCCTGG + Intronic
1025051812 7:55739183-55739205 CAGCCTCGGGGGCTGCTCCGTGG + Intergenic
1025207313 7:57001253-57001275 GAGCCTGGGTGGGCGGCCCCTGG - Intergenic
1025664624 7:63575633-63575655 GAGCCTGGGTGGGCGGCCCCTGG + Intergenic
1029491921 7:100875343-100875365 GAGCCTGGGGGGCCCCGCTGGGG + Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1031688728 7:124764264-124764286 GAGCCTGGGGGTCCCCGCCGGGG - Exonic
1034197854 7:149262020-149262042 GAGGGTGGGTGGCCGCGCCTGGG + Intergenic
1034733984 7:153412220-153412242 GAGCCACAGCGGCCGCTCCGAGG + Intergenic
1034983697 7:155494655-155494677 GAGCCTGGGCGGCGGGTTCGGGG + Intronic
1035098680 7:156378595-156378617 GGGGCTGGGTGGCCTCTGCGAGG + Intergenic
1036655113 8:10672804-10672826 GAGCCGGGGTGGCTGCCCCGGGG - Intronic
1038927746 8:32158920-32158942 GAGCCTGTGTGGTGGCTCAGGGG - Intronic
1039886293 8:41655970-41655992 AGGCCTGGGTGGCGGCTCTGAGG - Intronic
1048302004 8:133258634-133258656 GAGCCTGGGTGGCGGCCAGGAGG - Intronic
1048836614 8:138524788-138524810 GAACCTGGGTGTCTGCTACGGGG + Intergenic
1049002768 8:139836687-139836709 GAGCCTTGGTGTCTGCTCCTGGG - Intronic
1049830759 8:144699600-144699622 GAGGCTGTGTGGGCGCTCGGCGG + Intergenic
1053783619 9:41634911-41634933 GAGACAGGGTGGCCTCTCTGGGG - Intergenic
1054171573 9:61845053-61845075 GAGACAGGGTGGCCTCTCTGGGG - Intergenic
1054665961 9:67735759-67735781 GAGACAGGGTGGCCTCTCTGGGG + Intergenic
1057218427 9:93242661-93242683 GCACCTGGCTGGCCGCTCAGTGG + Intronic
1058439177 9:104991609-104991631 GGGCCAGGGTGGCAGCTCAGAGG + Intergenic
1061883119 9:133577861-133577883 CAGCCTGGGTGGGCGCTTGGTGG + Intergenic
1062432026 9:136530483-136530505 GAGCTGGGGTGGCCACTCTGGGG + Intronic
1062541049 9:137041675-137041697 CAGTCTGGGTGGACGCTCCCAGG + Intronic
1062737312 9:138144491-138144513 GAGCCTCAGGGGCAGCTCCGGGG + Intergenic
1062737323 9:138144525-138144547 GAGCCTCAGGGGCAGCTCCGGGG + Intergenic
1185747492 X:2584289-2584311 CTGCCTGGGTGGCTGCTCGGCGG + Intergenic
1187507127 X:19887213-19887235 GAGCCCGGGAGGGCGCCCCGGGG - Intronic
1200062613 X:153490266-153490288 GGGCCTGCGTGGGGGCTCCGGGG - Intronic
1200180028 X:154144415-154144437 GAGGCTGGGTGGCTGCACTGGGG + Intronic
1200185856 X:154182809-154182831 GAGGCTGGGTGGCTGCACTGGGG + Intergenic
1200191508 X:154219947-154219969 GAGGCTGGGTGGCTGCACTGGGG + Intronic
1200197263 X:154257751-154257773 GAGGCTGGGTGGCTGCACTGGGG + Intronic
1201573884 Y:15441276-15441298 GTGCCTGTGTGGCCTCTCTGTGG - Intergenic