ID: 1128635380

View in Genome Browser
Species Human (GRCh38)
Location 15:69299165-69299187
Sequence AGCCTGGGTGGCCGCTCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128635371_1128635380 -1 Left 1128635371 15:69299143-69299165 CCTGCGCCCGTGGAGCCCGTTGA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635364_1128635380 18 Left 1128635364 15:69299124-69299146 CCGCGGCAGCCCCAGCCGCCCTG 0: 1
1: 0
2: 5
3: 67
4: 665
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635368_1128635380 7 Left 1128635368 15:69299135-69299157 CCAGCCGCCCTGCGCCCGTGGAG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635374_1128635380 -8 Left 1128635374 15:69299150-69299172 CCGTGGAGCCCGTTGAGCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635372_1128635380 -7 Left 1128635372 15:69299149-69299171 CCCGTGGAGCCCGTTGAGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635370_1128635380 0 Left 1128635370 15:69299142-69299164 CCCTGCGCCCGTGGAGCCCGTTG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635367_1128635380 8 Left 1128635367 15:69299134-69299156 CCCAGCCGCCCTGCGCCCGTGGA 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635363_1128635380 21 Left 1128635363 15:69299121-69299143 CCTCCGCGGCAGCCCCAGCCGCC 0: 1
1: 0
2: 13
3: 191
4: 2302
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635369_1128635380 3 Left 1128635369 15:69299139-69299161 CCGCCCTGCGCCCGTGGAGCCCG 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635361_1128635380 25 Left 1128635361 15:69299117-69299139 CCGCCCTCCGCGGCAGCCCCAGC 0: 1
1: 0
2: 3
3: 69
4: 732
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635362_1128635380 22 Left 1128635362 15:69299120-69299142 CCCTCCGCGGCAGCCCCAGCCGC 0: 1
1: 0
2: 2
3: 34
4: 399
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635360_1128635380 26 Left 1128635360 15:69299116-69299138 CCCGCCCTCCGCGGCAGCCCCAG 0: 1
1: 0
2: 5
3: 62
4: 546
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635365_1128635380 9 Left 1128635365 15:69299133-69299155 CCCCAGCCGCCCTGCGCCCGTGG 0: 1
1: 0
2: 1
3: 18
4: 229
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128635380 Original CRISPR AGCCTGGGTGGCCGCTCCGA GGG Intronic