ID: 1128635380

View in Genome Browser
Species Human (GRCh38)
Location 15:69299165-69299187
Sequence AGCCTGGGTGGCCGCTCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128635367_1128635380 8 Left 1128635367 15:69299134-69299156 CCCAGCCGCCCTGCGCCCGTGGA 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635370_1128635380 0 Left 1128635370 15:69299142-69299164 CCCTGCGCCCGTGGAGCCCGTTG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635371_1128635380 -1 Left 1128635371 15:69299143-69299165 CCTGCGCCCGTGGAGCCCGTTGA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635364_1128635380 18 Left 1128635364 15:69299124-69299146 CCGCGGCAGCCCCAGCCGCCCTG 0: 1
1: 0
2: 5
3: 67
4: 665
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635369_1128635380 3 Left 1128635369 15:69299139-69299161 CCGCCCTGCGCCCGTGGAGCCCG 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635372_1128635380 -7 Left 1128635372 15:69299149-69299171 CCCGTGGAGCCCGTTGAGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635365_1128635380 9 Left 1128635365 15:69299133-69299155 CCCCAGCCGCCCTGCGCCCGTGG 0: 1
1: 0
2: 1
3: 18
4: 229
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635361_1128635380 25 Left 1128635361 15:69299117-69299139 CCGCCCTCCGCGGCAGCCCCAGC 0: 1
1: 0
2: 3
3: 69
4: 732
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635362_1128635380 22 Left 1128635362 15:69299120-69299142 CCCTCCGCGGCAGCCCCAGCCGC 0: 1
1: 0
2: 2
3: 34
4: 399
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635368_1128635380 7 Left 1128635368 15:69299135-69299157 CCAGCCGCCCTGCGCCCGTGGAG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635374_1128635380 -8 Left 1128635374 15:69299150-69299172 CCGTGGAGCCCGTTGAGCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635363_1128635380 21 Left 1128635363 15:69299121-69299143 CCTCCGCGGCAGCCCCAGCCGCC 0: 1
1: 0
2: 13
3: 191
4: 2302
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1128635360_1128635380 26 Left 1128635360 15:69299116-69299138 CCCGCCCTCCGCGGCAGCCCCAG 0: 1
1: 0
2: 5
3: 62
4: 546
Right 1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128635380 Original CRISPR AGCCTGGGTGGCCGCTCCGA GGG Intronic
900129201 1:1080465-1080487 GGCCTGGGGGGCTGCTCAGAGGG + Intergenic
900516619 1:3085231-3085253 AGCCTGGGTGGGTGCTGGGAGGG + Intronic
900934649 1:5757420-5757442 CGCCCGGGCGGCCGCTCAGAAGG + Intergenic
908062998 1:60372094-60372116 AGCCTGGGTGGCCAGGCAGAAGG + Intergenic
911163269 1:94702613-94702635 GGCCTGGGTGGCCTCACCTAAGG + Intergenic
913087761 1:115455031-115455053 AGCTTGGGAGGCCGCCCAGAGGG - Intergenic
923071416 1:230568269-230568291 AGCCTGTGTGGGCGCTCCAGTGG + Intergenic
1064109170 10:12523258-12523280 AGACTGGGTGGCCGGGCAGAGGG + Intronic
1066437376 10:35406882-35406904 TGCCTGGCCGGCCGCCCCGACGG - Intronic
1067166450 10:43869581-43869603 AGCCTGGGTGGTGGCTCTGGTGG + Intergenic
1073095716 10:100978579-100978601 AGTGTGGGTGGCGGCTCCGGCGG - Exonic
1074863732 10:117532809-117532831 AGCCTGGGTGCCCGATGCGGAGG - Intergenic
1074975022 10:118572939-118572961 AGCCTGGCTGGCCTCTACAAAGG + Intergenic
1076093082 10:127705636-127705658 AGCCAGGCTGGCTGCTCTGAAGG - Intergenic
1076789754 10:132770563-132770585 AGCCTCGCTGGCCGCCCCGGTGG + Intronic
1082706148 11:56497035-56497057 AGACTGGGTGGCCGAGCAGAGGG - Intergenic
1084567329 11:69938627-69938649 CGCCTGGGTGGCCGGTCAGCAGG - Intergenic
1090923596 11:131230427-131230449 ATCCTGGGAGGCCACTCCTATGG - Intergenic
1091776746 12:3189622-3189644 AGCCTGGATGGCTGATTCGAGGG + Intronic
1103604867 12:122078981-122079003 GGCCGGGGTGGCCGCGCCGGAGG - Exonic
1103807424 12:123584385-123584407 AGCCTGGACGGCGGCTCCGAAGG - Intergenic
1104769910 12:131354930-131354952 AGCCTGGGAGGCCCCTCGGGGGG - Intergenic
1105760090 13:23506170-23506192 AGCCAGAGTGACAGCTCCGAAGG + Intergenic
1106070489 13:26406746-26406768 AGCCTGGATGGCAGCACCCAGGG - Intergenic
1106747768 13:32721870-32721892 AGACTGGGTGGCCGGGCAGAGGG + Intronic
1107562658 13:41571946-41571968 AGACTGGGCGGCCGGTCAGAGGG - Intronic
1114594380 14:23898718-23898740 AAACTGGGTGGCCGGTCAGAGGG + Intergenic
1118610237 14:67533679-67533701 AGCCTGCACGTCCGCTCCGAGGG - Intronic
1122588167 14:102825583-102825605 AGCCTGAGTGGGCTCTCCGTGGG - Intronic
1125348114 15:38740302-38740324 AGCCTGGGTGGCCTCGGCCAGGG - Intergenic
1126573119 15:50172625-50172647 AGACTGGGTGGCCGGGCAGAGGG - Intronic
1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG + Intronic
1129880565 15:79003766-79003788 AGGCTGGGGGGCAGCTCCGACGG + Intronic
1132858127 16:2056574-2056596 AGCCTGGGTGTCCTCTCCTGTGG + Intronic
1136518418 16:30781729-30781751 CACCTGGGTGGCAGCTCCTATGG + Exonic
1139433157 16:66921953-66921975 TGCCCGGCTGGCAGCTCCGAGGG + Exonic
1147944703 17:44074338-44074360 AGCCTGGGTGGCCCAACCAAAGG + Intronic
1151392588 17:73797695-73797717 AGCCTGGCTGGCTCCTCTGAAGG - Intergenic
1152387200 17:79981713-79981735 AGCCGAGGGAGCCGCTCCGAGGG - Intronic
1154089557 18:11344527-11344549 AGACTGGGTGGCCGGGCAGAGGG - Intergenic
1155221641 18:23690300-23690322 AGCCTGGCGGGACGCTCCGTGGG - Intronic
1156601187 18:38609077-38609099 AGCCTGGGTGCAGGCTCCCAGGG - Intergenic
1160200858 18:76794080-76794102 AGCATGGGTGGCTGGTCCGGTGG + Intergenic
1164054964 19:21614773-21614795 AGACTGGGTGGCCGGGCAGAGGG - Intergenic
1165875118 19:39001139-39001161 AGCTGGGGTGGCCTGTCCGAGGG + Intronic
930091620 2:47535153-47535175 AGCCTGGTTGGCTGCTTCAAAGG + Intronic
932279861 2:70481233-70481255 AGGCTGGGTGTCCTCTCCCAGGG - Intronic
940274371 2:151923543-151923565 AGCCTGGGTGGAGGCCCGGATGG + Intronic
940817330 2:158310872-158310894 AGACTGGGTGGCCGGGCAGAGGG + Intronic
1169059671 20:2652515-2652537 ACCCTGGGCGGCCCCTCCAAAGG + Exonic
1171966946 20:31537757-31537779 GGCCTGGGTGGCCACTCTGTAGG + Intronic
1175801322 20:61802691-61802713 AGGCTGGGAGGCAGCTCCCAGGG - Intronic
1175874234 20:62221870-62221892 GGCATGGGTGGCAGCTCTGATGG - Intergenic
1175926307 20:62473261-62473283 AGCCTGGGTGCCCGCCCCGGTGG - Intronic
1179881394 21:44294592-44294614 ACCCTGGGTGCCAGCTTCGAGGG + Intronic
1180861214 22:19084202-19084224 AGACTGGGCGGCCGGTCAGAGGG - Intronic
1182669541 22:31984220-31984242 AGGCTGGCTGGCCTCTCTGAGGG + Intergenic
1183735402 22:39642222-39642244 AGGGTGGGTGGCCGCTCAGGGGG + Intronic
1184201291 22:42971567-42971589 AGACTGGGTGGCCGGGCAGAGGG - Intronic
1184752051 22:46492127-46492149 AGCCTGGGAAGCAGCCCCGAGGG - Intronic
1185079375 22:48701321-48701343 AAGCTGGGTGGCAGCTCCCAGGG + Intronic
950659469 3:14457971-14457993 AGCCTGGGTGGTCGATTCCAGGG - Exonic
954639402 3:52089091-52089113 GGACTGGGTGGCAGCTCCCATGG - Intronic
961558112 3:127710525-127710547 AGCTTGGGTGGCTGCCCCCATGG - Intronic
969364788 4:6688022-6688044 TGCCTGGGTAGCCGCTCCATGGG + Intergenic
969542984 4:7805329-7805351 AGCCTGGGTAGCCATTCCCAGGG - Intronic
973650372 4:52992509-52992531 AGACTGGGTGGCCGGGCAGAGGG - Intronic
975176976 4:71300186-71300208 AGCCTGGGAGGGGGCTCTGATGG + Intronic
975795986 4:78007400-78007422 AGACTGGGTGGCCGGGCAGACGG + Intergenic
976672148 4:87665629-87665651 AGCCTGGCTGGCAGCTTCCAAGG + Intergenic
977542221 4:98330811-98330833 AGACTGGGTGGCCGGGCAGAGGG + Intronic
979574008 4:122265171-122265193 ATCCTGGGTGGCGGATCAGAGGG - Intronic
980383957 4:132062725-132062747 AGACTGGCTGGCAGCTCCGCCGG - Intergenic
983664524 4:170166600-170166622 AGACTGGGTGGCCGGGCAGAGGG + Intergenic
984702635 4:182827977-182827999 AGCCTGTGTGTCCGCTCTGCAGG - Intergenic
985513091 5:322835-322857 CGCCTGGGGAGCCGCTTCGACGG + Intronic
993934620 5:93985905-93985927 AGACTGGGTGGCCGGGCAGAGGG - Intronic
997531103 5:134581737-134581759 AGGCTGGCTGGCTGCTGCGAGGG + Exonic
1002927170 6:1611277-1611299 AGGCTGAGCGGCCGCGCCGACGG - Exonic
1003152972 6:3568485-3568507 AGACTGGGTGACAGCTCAGAGGG + Intergenic
1003869443 6:10390431-10390453 AGCCTGGAGGGCCGCTCCTGGGG - Intergenic
1006395243 6:33782892-33782914 AGCCTGGGGGGCCGCCTTGAAGG - Intronic
1008092842 6:47309707-47309729 CGCCTGGGCGGCCGCGCCGCTGG - Exonic
1019660460 7:2221070-2221092 AGCCGAGGTGGCCGCTCCTCAGG - Intronic
1019732581 7:2636048-2636070 AGGCTGGATGGCCACTCAGAGGG + Intronic
1025051813 7:55739184-55739206 AGCCTCGGGGGCTGCTCCGTGGG + Intergenic
1033227251 7:139571832-139571854 AGCTAGGGTGGCGGCGCCGAGGG + Exonic
1035098681 7:156378596-156378618 GGGCTGGGTGGCCTCTGCGAGGG + Intergenic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1047202908 8:122781593-122781615 AGCCCGGGTGGCAGCTCGGGTGG + Exonic
1048302003 8:133258633-133258655 AGCCTGGGTGGCGGCCAGGAGGG - Intronic
1052056681 9:23914688-23914710 GGGCTGGCTGGCTGCTCCGAGGG + Intergenic
1052236275 9:26215411-26215433 AGACTGGGCGGCCGGTCAGAGGG + Intergenic
1057042393 9:91857153-91857175 AGGCTGGGTGGCCTCCCCGATGG - Intronic
1058439178 9:104991610-104991632 GGCCAGGGTGGCAGCTCAGAGGG + Intergenic
1062418386 9:136465902-136465924 AGGCTGGGTGGCCGCCCCAGTGG + Intronic
1189341985 X:40211285-40211307 AGACTGGGCGGCCGGTCAGAGGG + Intergenic
1191679426 X:63825832-63825854 AGACTGGGTGGCCGGGCAGAGGG + Intergenic
1192034141 X:67545443-67545465 AGCCTGTGGGGCCTCTACGATGG - Exonic
1192761235 X:74098252-74098274 AGACTGGGTGGCCGGGCAGAGGG - Intergenic
1198600891 X:138283135-138283157 AGTCTGGGTGGCCGGGCAGAGGG + Intergenic
1200119542 X:153783858-153783880 AGCCTGGGTGGCAGCCTCCATGG - Exonic
1200214560 X:154361905-154361927 AGCCTAGGGGACAGCTCCGAGGG - Intronic