ID: 1128635427

View in Genome Browser
Species Human (GRCh38)
Location 15:69299367-69299389
Sequence GATAAGCGGCGCAAACGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 9}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128635427_1128635443 27 Left 1128635427 15:69299367-69299389 CCAGGGCGTTTGCGCCGCTTATC 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1128635443 15:69299417-69299439 CCCCACTTTAATAAAACCCTTGG 0: 1
1: 0
2: 1
3: 3
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128635427 Original CRISPR GATAAGCGGCGCAAACGCCC TGG (reversed) Intronic
1065805839 10:29393142-29393164 GATAAGCTGAGCAAAAGGCCAGG + Intergenic
1093175776 12:15911584-15911606 GACAAGCGGCGCGAACGTGCCGG - Intronic
1119157147 14:72421749-72421771 GATAAGGGGTGCAACTGCCCAGG - Intronic
1128635427 15:69299367-69299389 GATAAGCGGCGCAAACGCCCTGG - Intronic
1138514668 16:57529375-57529397 GATCAGCCGCGCCAAGGCCCTGG + Intronic
1146184088 17:30713647-30713669 GAACAGCAGTGCAAACGCCCCGG - Intergenic
1160818278 19:1046335-1046357 GCTCAGCGGCGCCAACCCCCGGG + Exonic
979995374 4:127425693-127425715 GATAAGCAGCAGAAAGGCCCTGG + Intergenic
997291200 5:132737154-132737176 GATAAGCGGCGCAGGCCCCACGG + Intronic
1034253964 7:149714594-149714616 GATAAGCGGCGCGTACCCGCGGG + Intergenic