ID: 1128636326

View in Genome Browser
Species Human (GRCh38)
Location 15:69304782-69304804
Sequence ATGGTCAGGTTCACCTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128636321_1128636326 -10 Left 1128636321 15:69304769-69304791 CCCTTTGACCAAGATGGTCAGGT 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1128636326 15:69304782-69304804 ATGGTCAGGTTCACCTTGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 90
1128636315_1128636326 23 Left 1128636315 15:69304736-69304758 CCTTCAGACAGTCTTCCTCTGAT 0: 1
1: 0
2: 4
3: 9
4: 221
Right 1128636326 15:69304782-69304804 ATGGTCAGGTTCACCTTGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 90
1128636314_1128636326 24 Left 1128636314 15:69304735-69304757 CCCTTCAGACAGTCTTCCTCTGA 0: 1
1: 0
2: 6
3: 25
4: 267
Right 1128636326 15:69304782-69304804 ATGGTCAGGTTCACCTTGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 90
1128636318_1128636326 8 Left 1128636318 15:69304751-69304773 CCTCTGATTATCTGGGAACCCTT 0: 1
1: 0
2: 2
3: 12
4: 163
Right 1128636326 15:69304782-69304804 ATGGTCAGGTTCACCTTGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 90
1128636313_1128636326 25 Left 1128636313 15:69304734-69304756 CCCCTTCAGACAGTCTTCCTCTG 0: 1
1: 0
2: 2
3: 51
4: 341
Right 1128636326 15:69304782-69304804 ATGGTCAGGTTCACCTTGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128636326 Original CRISPR ATGGTCAGGTTCACCTTGGT GGG Intronic
901381867 1:8879347-8879369 AGGGACAGGGTCACCTTGGCGGG - Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
911391658 1:97252339-97252361 ATTGTCAGGACCAACTTGGTGGG + Intronic
917015264 1:170523378-170523400 ATTGTCAGTTTTACCTTGTTGGG - Intergenic
920070456 1:203299139-203299161 ATGGTCAGCTTTGCCTTGGGGGG + Intergenic
922683198 1:227618003-227618025 ATAGTCAGGTTGGCCTTGGTGGG - Intronic
922756676 1:228100882-228100904 CTGGGCAGGTTCACCTTCGCAGG + Exonic
1067031492 10:42880835-42880857 AGGGTCAGGTTCAGGTTGCTGGG + Intergenic
1067895372 10:50173897-50173919 ATCCTCAGGTTCCCCTTGGCAGG + Intergenic
1067953614 10:50768081-50768103 ATCCTCAGGTTCCCCTTGGCAGG - Intronic
1075330281 10:121569053-121569075 ATGATCAGGTTCATCTTCGTTGG - Intronic
1076826979 10:132974052-132974074 ATGGCCAGGCTGTCCTTGGTTGG - Intergenic
1077890688 11:6416057-6416079 GGGGTCATGTTGACCTTGGTAGG - Intronic
1079696291 11:23485710-23485732 ATTGTCAGATTCACCAAGGTTGG + Intergenic
1081308881 11:41546406-41546428 ATTGTCAGATTCACCAAGGTTGG + Intergenic
1085434048 11:76482946-76482968 ATCGTCAGATTCACCAAGGTTGG + Intronic
1085695661 11:78702389-78702411 ATTGTCAGGTTCACCTGGAGTGG - Exonic
1089601642 11:119619279-119619301 ATGGTCAGATTGTCCTTGTTTGG - Intergenic
1092007638 12:5083087-5083109 TTGCTCAGGTTCACCATGGGAGG + Intergenic
1098881933 12:75926207-75926229 AGGCCCAGGTTCACCATGGTTGG - Intergenic
1100530776 12:95459561-95459583 AAGGACAGGTTCACCTAGCTAGG + Intergenic
1106832565 13:33601381-33601403 ACGATCAGGTTCACCTTGTAAGG - Intergenic
1115474613 14:33800804-33800826 ATGGCCAGGGTCACCTCGGCGGG - Exonic
1125094159 15:35831599-35831621 ATGTTCAGTTTCACCTAGTTAGG - Intergenic
1125337056 15:38637091-38637113 ATGGCCAAGTTCAACATGGTGGG - Intergenic
1127191870 15:56539733-56539755 AATGTCAGGTTCTCCTTGATAGG + Intergenic
1127854870 15:62945950-62945972 ATGGACAGTTTCACTTTGGGTGG + Intergenic
1128636326 15:69304782-69304804 ATGGTCAGGTTCACCTTGGTGGG + Intronic
1128695936 15:69762893-69762915 ATGGTCAGGATGTCCTTGCTGGG + Intergenic
1131367198 15:91851687-91851709 CTGGTCAGGTTAACCTTTCTAGG + Intergenic
1132464544 16:71690-71712 CTGGTCAGGACCACCTCGGTCGG + Intronic
1135898432 16:26431914-26431936 ATTTTCAGTTTCACCTTAGTAGG - Intergenic
1136036917 16:27547555-27547577 ATGGTCTGGCTTACCATGGTGGG - Intronic
1136598117 16:31265774-31265796 ATGGGCATGGTCACCCTGGTGGG - Intronic
1137243170 16:46676752-46676774 ATGGTAAAGTTCACATTTGTGGG + Intronic
1138054413 16:53816820-53816842 ATTGTCTGGCTCACCTTGCTAGG + Intronic
1141095623 16:81160847-81160869 CTGGTCAGGTTCAACACGGTCGG + Intergenic
1142348383 16:89568654-89568676 ATGTTCAGCTTCATCTTGGCCGG + Intergenic
1143049920 17:4116688-4116710 CTGGTCAGGGTCACCTTTGCAGG - Intronic
1143462213 17:7111094-7111116 ATTGTCAATTTCACCTTGTTGGG - Intronic
1150833348 17:68542531-68542553 ATGGTCAGGCAGACCATGGTGGG + Intronic
1151231563 17:72688820-72688842 AAGGTCAGGTTCCCCCTGGTGGG + Intronic
1153116994 18:1670372-1670394 ATGGACAGATTCATCTTGGTTGG + Intergenic
1154288420 18:13083068-13083090 ATTGTCAGATTCACCAAGGTTGG - Intronic
1157835333 18:50896810-50896832 ATGGTCAAATTCCCCTTTGTAGG - Intronic
1164417475 19:28058963-28058985 ATGGTCATGTACACCTGGGCTGG - Intergenic
930004188 2:46882869-46882891 ATGGTCAGCTTCTCCTGGGCAGG - Intergenic
930250918 2:49033351-49033373 ATGCTCAGGTTCTTCTTGGCAGG - Intronic
931175510 2:59850585-59850607 ATGGCCAGGCTTACCTTGTTAGG + Intergenic
934906706 2:98211109-98211131 ATGGACAGGATAACCTGGGTTGG - Intronic
939701283 2:145395033-145395055 ATGTTCAGTTTCACATTGCTTGG - Intergenic
939838831 2:147162408-147162430 ATGGTATGGCTCTCCTTGGTTGG - Intergenic
943377156 2:187091813-187091835 GTGGTATGCTTCACCTTGGTGGG - Intergenic
1172059791 20:32179448-32179470 ATTGTGAGTTTCACCTTGTTGGG + Intergenic
1172806998 20:37619148-37619170 ATGGTCATGGTCATCATGGTTGG + Intergenic
1175503956 20:59469094-59469116 ATGGTCAGCTGCACCCTGGAGGG + Intergenic
1177987286 21:27992488-27992510 AAGGTCATGTTCAGTTTGGTGGG - Intergenic
1178187662 21:30242047-30242069 ATGATCAGTTTTGCCTTGGTGGG - Intergenic
1181802160 22:25354733-25354755 ATTTTCAGGTTCACCCTGCTGGG - Exonic
1181912356 22:26248884-26248906 ATGGGCAGGTTCCCCTAGGAAGG - Intronic
949328896 3:2899395-2899417 ATTATTAGGTTTACCTTGGTAGG + Intronic
949427089 3:3929329-3929351 ATGGTTTGGATCACCTTGCTAGG - Intronic
949572398 3:5306136-5306158 ACGGCCAGGTTCACCCTGCTGGG - Intergenic
953215413 3:40913552-40913574 ATGGGCTGGGTCACCTTGGCAGG + Intergenic
953536944 3:43783843-43783865 ATGGTCAGTTTCAGCTTGGAGGG + Intergenic
953564353 3:44018378-44018400 ATGGAAAAGTTCATCTTGGTGGG - Intergenic
962416989 3:135192229-135192251 ATGGTCAGTTTCACTTTGGCAGG - Intronic
962743718 3:138382053-138382075 AAGGGCAGCTTCCCCTTGGTGGG - Intronic
963654296 3:148025456-148025478 ATGGTCAGGATTACCTGGGAAGG + Intergenic
966918576 3:184598026-184598048 AGGGTCAGGTTGACCTTGGCAGG - Intronic
968180308 3:196590318-196590340 TTGGTCATCTTCACCTTGGAAGG + Intergenic
970406722 4:15770955-15770977 GTGGTCAGGTAGACCTGGGTGGG - Intergenic
976526693 4:86099926-86099948 AAGGTCAGGTTCACCCTGGTGGG - Intronic
976551750 4:86403984-86404006 ATGGTAAGTTTAACCTTGGGAGG - Intronic
977643351 4:99382911-99382933 ATGGTCTGGTTTATTTTGGTTGG + Intergenic
977864526 4:102008635-102008657 ATGGGCTGTTTCTCCTTGGTAGG - Intronic
981447288 4:144854700-144854722 ATGGTCGGTTTCAGCTTGGCTGG + Intergenic
981529414 4:145737070-145737092 ATAATCTGGTTCAACTTGGTAGG + Intronic
984884191 4:184435596-184435618 AATGTCAGGTTCACCTTCCTGGG - Intronic
986376950 5:7142026-7142048 ACTGTTAAGTTCACCTTGGTTGG + Intergenic
998884081 5:146676011-146676033 ATGGGCGGATTCACCTTGGAGGG + Intronic
1006762049 6:36471583-36471605 TTGCTCAGGTTCACATTGCTAGG + Intronic
1011098086 6:83688757-83688779 ATGGTGATGTTCACTTTGGGAGG - Intronic
1011494547 6:87925485-87925507 ATGGTCAGGTGGACTGTGGTGGG - Intergenic
1014843898 6:126252298-126252320 AGGGTCAGGTTCACCTGGGATGG + Intergenic
1021038773 7:15835004-15835026 TTGGTCAAGTTCACCTAAGTAGG + Intergenic
1026195844 7:68172895-68172917 ATTGCCAGGTTAACATTGGTGGG + Intergenic
1030717692 7:112829589-112829611 ATGGTGAATTTTACCTTGGTGGG + Intronic
1032403826 7:131641787-131641809 ATGGTCAGCTTCACCTGCCTGGG - Intergenic
1033528662 7:142242265-142242287 ATGGTCATGGTGACCATGGTGGG + Intergenic
1035626664 8:1076170-1076192 AACGTCAGGTTCACCTTCATGGG - Intergenic
1037734324 8:21554774-21554796 AAGGGCAGGATCACCTGGGTAGG + Intergenic
1039633897 8:39142650-39142672 ATTGTCAGATTCACCAAGGTTGG - Intronic
1047235511 8:123038972-123038994 ATGGTCAGGGATACCTGGGTTGG - Intronic
1047370450 8:124251889-124251911 ATGGACATGTCCACCTTGGCAGG - Intergenic
1056447026 9:86676093-86676115 AAGGGCAGATTCGCCTTGGTAGG + Intergenic
1058718180 9:107740468-107740490 ATCGTCTGGGTCACCTGGGTTGG + Intergenic
1060816542 9:126638246-126638268 ATGGGCAGGTGCACCTGGGAGGG - Intronic
1189572711 X:42316138-42316160 ATGCTCAGAATCACCTTTGTAGG - Intergenic
1192544638 X:72003465-72003487 ATGCTCAGGTTCAGCTGGGTGGG + Intergenic
1192826072 X:74697402-74697424 ATGGTCAGATTCACCAAGGTTGG + Intergenic
1195883862 X:109620192-109620214 AAGGTCACGTTCACCTAGGCTGG + Intergenic