ID: 1128636490

View in Genome Browser
Species Human (GRCh38)
Location 15:69305698-69305720
Sequence CTCTCCCTCCTCTGCTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 333}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128636490_1128636498 9 Left 1128636490 15:69305698-69305720 CCCACCAAGCAGAGGAGGGAGAG 0: 1
1: 0
2: 2
3: 36
4: 333
Right 1128636498 15:69305730-69305752 TGTGGGTGTTGTTAGACGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 131
1128636490_1128636499 10 Left 1128636490 15:69305698-69305720 CCCACCAAGCAGAGGAGGGAGAG 0: 1
1: 0
2: 2
3: 36
4: 333
Right 1128636499 15:69305731-69305753 GTGGGTGTTGTTAGACGCAAGGG 0: 1
1: 0
2: 0
3: 1
4: 53
1128636490_1128636500 24 Left 1128636490 15:69305698-69305720 CCCACCAAGCAGAGGAGGGAGAG 0: 1
1: 0
2: 2
3: 36
4: 333
Right 1128636500 15:69305745-69305767 ACGCAAGGGCACGCCTGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1128636490_1128636497 -8 Left 1128636490 15:69305698-69305720 CCCACCAAGCAGAGGAGGGAGAG 0: 1
1: 0
2: 2
3: 36
4: 333
Right 1128636497 15:69305713-69305735 AGGGAGAGAGGGTGGAGTGTGGG 0: 1
1: 0
2: 13
3: 142
4: 1499
1128636490_1128636496 -9 Left 1128636490 15:69305698-69305720 CCCACCAAGCAGAGGAGGGAGAG 0: 1
1: 0
2: 2
3: 36
4: 333
Right 1128636496 15:69305712-69305734 GAGGGAGAGAGGGTGGAGTGTGG 0: 1
1: 2
2: 35
3: 445
4: 3049

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128636490 Original CRISPR CTCTCCCTCCTCTGCTTGGT GGG (reversed) Intronic
900956868 1:5891746-5891768 CGCTCCTTCCTCTGCTCGTTGGG - Intronic
901089150 1:6629882-6629904 CTCTGCCAGCTCTGCTTTGTGGG + Intronic
901929735 1:12589462-12589484 CACTGCCTCCTCTGCTTCCTGGG + Intronic
902023081 1:13362416-13362438 ATCAGCCTCTTCTGCTTGGTAGG - Intergenic
903866253 1:26400492-26400514 CTCTCCCCTGTCTGTTTGGTGGG - Intergenic
905425721 1:37882701-37882723 CTCTTCCTCCTTGGCTTGGGAGG - Intronic
905884418 1:41484202-41484224 CTCTCCCTCCTGTGCATGCAGGG - Exonic
906277067 1:44524293-44524315 CTCTCCCACCTCGGGTAGGTGGG + Intronic
906656264 1:47550450-47550472 TTCTCCCTCCTCAGCTTCCTGGG + Intergenic
907987024 1:59542354-59542376 ATCTCCCTCCTCTGTTTAGAAGG - Intronic
909736288 1:78966643-78966665 CTCCCCCTCCTCTTCCAGGTGGG + Intronic
910401186 1:86839744-86839766 CTTTCCCTCCACTTCTTGGTTGG - Intergenic
910430015 1:87151260-87151282 CTCTCCTTTCTCTACTGGGTAGG + Intronic
910654413 1:89605415-89605437 CCGTCCCTCCTCTTCATGGTAGG - Intergenic
910747407 1:90588731-90588753 CTTTACATCCTCTGCTTGTTGGG - Intergenic
913601106 1:120421742-120421764 CTCCTCCTCCTCTGATTTGTGGG + Intergenic
914085939 1:144454859-144454881 CTCCTCCTCCTCTGATTTGTGGG - Intronic
914191836 1:145418839-145418861 CTCCTCCTCCTCTGATTTGTGGG - Intergenic
914362294 1:146945298-146945320 CTCCTCCTCCTCTGATTTGTGGG + Intronic
914489380 1:148141785-148141807 CTCCTCCTCCTCTGATTTGTGGG - Intronic
914589761 1:149096840-149096862 CTCCTCCTCCTCTGATTTGTGGG - Intronic
915559939 1:156681305-156681327 CTTTCCCTCCTCTGCTCAGAGGG + Intergenic
915601207 1:156924265-156924287 CACTCGCGCCTCTGCTGGGTTGG - Intronic
916530908 1:165655403-165655425 ATCGCCCTCCTGGGCTTGGTGGG + Exonic
917491775 1:175504380-175504402 ACCTGCCTCCTCTGCTTGGGTGG - Intronic
918907146 1:190511322-190511344 TTTTCTCTCCTCTTCTTGGTGGG - Intergenic
919718965 1:200811186-200811208 CAAGCCCTCCTCTACTTGGTGGG + Intronic
919765345 1:201123729-201123751 CTCTTCCTCCTCCCCTTGGGTGG - Intronic
919957600 1:202434747-202434769 CTCTGCCTCTTCTGCTAGGAGGG + Exonic
920600686 1:207321430-207321452 CACTCTCTCCACTGCTGGGTGGG - Intergenic
922118410 1:222636880-222636902 CTCTGCCTCCTCTGCAAGATTGG + Intronic
1063508480 10:6623637-6623659 CACTCCCTCCTCTGGTTTGCCGG - Intergenic
1064682067 10:17820073-17820095 CTCACCCTCCTCAGCGTGGGTGG - Intronic
1064736421 10:18386226-18386248 CTCTCCTTCCCCTGCTTTTTTGG + Intronic
1065650389 10:27882736-27882758 CTGTCCCTCCTATGGTTTGTAGG - Intronic
1065887566 10:30092243-30092265 CTCCCCTTCCTCTGCTTTCTCGG - Intronic
1067076472 10:43188826-43188848 CTTGTCCTCCTATGCTTGGTAGG + Intergenic
1067499300 10:46787174-46787196 CTCTCCCTTTTCTTCTTGGTGGG - Intergenic
1067595329 10:47553150-47553172 CTCTCCCTTTTCTTCTTGGTGGG + Intergenic
1069118617 10:64539381-64539403 GTCTCCCTTCTCTGCAGGGTAGG - Intergenic
1069521549 10:69124963-69124985 CCCTCCCTCCTCTGCCTCATAGG - Intronic
1069678402 10:70266220-70266242 ATCTTCCTGCTCTGCATGGTGGG - Exonic
1070139694 10:73730140-73730162 CTCTCCCTTTTCTTCTTGGTGGG + Intergenic
1071012831 10:80957856-80957878 CTCTCCATCATCTTCTAGGTAGG + Intergenic
1071265886 10:83964538-83964560 CTCCTCATCCTCTGCCTGGTTGG - Intergenic
1072231477 10:93417599-93417621 CCCACTCTCTTCTGCTTGGTAGG - Intronic
1072582771 10:96753984-96754006 CACTCTCTCCTCTGTTCGGTGGG + Intergenic
1072611185 10:97018600-97018622 CTCGCCCTCCTGTGCATGGCAGG + Exonic
1073006068 10:100325713-100325735 CTCACCCTCCACTGCTGGCTGGG + Intronic
1074148863 10:110740597-110740619 CTCTCCCACCAGGGCTTGGTAGG + Intronic
1074171792 10:110947136-110947158 CTCTCCTTCCTCCACTTGGAGGG - Intronic
1074231478 10:111540362-111540384 CTCTGCCTCTTTTGCTTGGTGGG - Intergenic
1074298241 10:112210621-112210643 CTCTCCCACCTTTCCTGGGTGGG - Intronic
1074315540 10:112357992-112358014 CTCTGTCTCCTCTGCTAGGACGG + Intergenic
1076445243 10:130509813-130509835 CTGCCCCACCTCTGTTTGGTGGG + Intergenic
1076581457 10:131514738-131514760 CGCGCCCTCCTTTGCTTGGCGGG + Intergenic
1077044900 11:540423-540445 CTCGACCCCCTCTGCTTCGTAGG - Intronic
1080661505 11:34300023-34300045 CTCTGCCTCCTACGCTTGGTGGG + Intronic
1080980892 11:37404130-37404152 CTCTCCCCACACAGCTTGGTAGG + Intergenic
1083281517 11:61629756-61629778 CCCACCCCCCACTGCTTGGTGGG - Intergenic
1084076539 11:66782519-66782541 CTCTGCCTCCTCAGCTTAGTGGG + Intronic
1086081138 11:82903017-82903039 CTTTCCCTCTTTTGCATGGTTGG - Intronic
1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG + Exonic
1088396564 11:109376280-109376302 CTCTCCTTGCTCAGGTTGGTTGG + Intergenic
1089345174 11:117786493-117786515 CTCGCCCTCCACCGCTTGCTTGG + Intronic
1089695967 11:120216552-120216574 CTGTCCCTCCTCTGCGTGTGAGG + Intronic
1090408933 11:126494679-126494701 CTCTCTATCCTGTCCTTGGTGGG + Intronic
1090508691 11:127347992-127348014 CTCTTCGTCCTCTGCTTGAAAGG + Intergenic
1090660372 11:128877939-128877961 CTGTCTCCCCTCTGCTTGCTGGG - Intergenic
1091316231 11:134615867-134615889 CTCTCCCTCTGCTCGTTGGTGGG + Intergenic
1091393357 12:139066-139088 CTCTTCCTCCTCTGTTTTGGGGG - Exonic
1092160447 12:6312678-6312700 GGCTCCCGCCTCTGCTTGGCAGG + Intronic
1092398725 12:8153079-8153101 CTCACTCTCTTCTGCTTTGTAGG + Intronic
1092884710 12:12914960-12914982 CTCCTCCTCCCTTGCTTGGTTGG - Exonic
1094839923 12:34338586-34338608 GCCTCCCTGCTCTGCTTCGTCGG - Intergenic
1095654098 12:44649137-44649159 TTCTCCTTAATCTGCTTGGTTGG - Intronic
1095822614 12:46495372-46495394 CTCTGCCTCCTCTGCCTCCTGGG + Intergenic
1096597982 12:52709313-52709335 CTCTCCACTCTCTTCTTGGTGGG - Intergenic
1096614251 12:52822839-52822861 CCATCACTCCTCTCCTTGGTTGG - Intronic
1097607002 12:61768158-61768180 CTCTCCCTCTACTGCTTTCTAGG - Intronic
1097762233 12:63479997-63480019 CTATCCCTGCTCTGAATGGTTGG - Intergenic
1097938289 12:65278087-65278109 CTCACCCTCCTCTGCTAGAGAGG + Intergenic
1100272584 12:93040561-93040583 TTCACCTTCCTCTGCTTGTTTGG - Intergenic
1100560557 12:95745250-95745272 CTCTCCCTTCTTTCCTTTGTTGG + Intronic
1100562348 12:95760503-95760525 CTCTGTCTCCTCAACTTGGTGGG + Intronic
1100563060 12:95768445-95768467 CTGACCCTCCTTGGCTTGGTGGG - Intronic
1100776883 12:97984951-97984973 CTCTCCCTCTTCTTCTAGTTTGG + Intergenic
1102498165 12:113333665-113333687 CTCTCCCTGCTGTGCAGGGTGGG - Intronic
1102829995 12:115989389-115989411 TTCTTCCTTCTCTGCTTGATAGG + Intronic
1103506349 12:121444154-121444176 CACTCACTCCTCCGCTTGGCAGG + Exonic
1103887778 12:124215777-124215799 CTCTCCCTTCTTTGCATAGTTGG + Intronic
1104063477 12:125287174-125287196 CCCTCCCTCCTCTGCTTCTGTGG + Intronic
1104837259 12:131799751-131799773 TTCTTCCTTCTCTCCTTGGTTGG + Intergenic
1105583174 13:21720159-21720181 CTCTGCCTTCTGTTCTTGGTAGG + Intergenic
1106161038 13:27201615-27201637 CTTTCCCTCCTCTATTTAGTGGG - Intergenic
1106921960 13:34573802-34573824 CCCTCCCTCCTGGGCTTGGAAGG - Intergenic
1109221356 13:59643964-59643986 TTTTCCATCCTCTGCTGGGTGGG - Intergenic
1110286337 13:73753992-73754014 CTCTCTCTCCTCTCCTGAGTGGG - Intronic
1110807927 13:79779742-79779764 CTCTCACTGCTCTGCTTCCTGGG + Intergenic
1112065038 13:95783932-95783954 CCCTCCCTCCTCTTCCTGGATGG - Intronic
1112257116 13:97844258-97844280 CTCTCCCGTCTCTGCATCGTGGG + Intergenic
1112922297 13:104628811-104628833 CCCCCCCCCCTCTGCTTTGTAGG + Intergenic
1113200637 13:107865625-107865647 CTTTCCTATCTCTGCTTGGTTGG - Intronic
1113951169 13:114071717-114071739 CTCTCACTCCTCGGCCTGGAGGG + Intronic
1114441106 14:22748716-22748738 CTCTCCCTTTTCTCCCTGGTGGG - Intergenic
1117558319 14:56909403-56909425 CTGGGCCTCCTCTGCTTGCTTGG + Intergenic
1117644993 14:57842495-57842517 CTCTCCCTCCCATGTCTGGTGGG - Intronic
1117994577 14:61466793-61466815 CTCCCGCTCCTCTGCCTGCTGGG + Intronic
1119854250 14:77887351-77887373 CTCTCCCTCTGCTGCTTGAAGGG - Intronic
1119885109 14:78133900-78133922 CTCTGCATCCTCTGCTTCCTGGG + Intergenic
1121629572 14:95412518-95412540 CTTTCTCTCCCCTGGTTGGTGGG - Intronic
1122368961 14:101217091-101217113 CTCACCATCCTCAGCTTGTTTGG - Intergenic
1122781937 14:104147413-104147435 CCCTTCCTCCTCTGCTGGGAGGG - Intronic
1123833846 15:24168368-24168390 CTCTCCCTCCAGTGCTTGACAGG - Intergenic
1123840583 15:24243416-24243438 CTCTCCCTCCAGTGCTTGACAGG - Intergenic
1123849631 15:24341941-24341963 CTCTCCCTCCAGTGCTTGACAGG - Intergenic
1123869501 15:24556536-24556558 CTCTCCCTCCAGTGCTTGACAGG - Intergenic
1125400003 15:39291926-39291948 CTCTCCCTCCTCCTACTGGTAGG + Intergenic
1125744908 15:41991462-41991484 CTCTGCCTGCTCTGCTTCATAGG + Intronic
1126497133 15:49304068-49304090 CTGTCACTCCTCTGCTGGTTTGG + Intronic
1127291603 15:57575983-57576005 CACTTCCTCCTCAGCTTGGAAGG + Intergenic
1128151772 15:65367673-65367695 CTCTCTCACTTCAGCTTGGTTGG + Intronic
1128162589 15:65434106-65434128 CTCTCCCTCCTCAGCTCTCTAGG + Intergenic
1128404836 15:67325014-67325036 CTCTCCCTCCTCTCCTTCTGGGG + Intronic
1128636490 15:69305698-69305720 CTCTCCCTCCTCTGCTTGGTGGG - Intronic
1128647052 15:69385402-69385424 CTCACCCTCCTCTTCTTGCCTGG - Intronic
1129148775 15:73673507-73673529 CTCTCCCAGCTCTGCTTGGAGGG - Intergenic
1129424462 15:75454090-75454112 CGCCCCCGCCTCTGATTGGTGGG - Intronic
1129669011 15:77596780-77596802 CTCTCCCTTCTCTGGTTCCTGGG - Intergenic
1132643312 16:987790-987812 CTCCCCCTGCTGTTCTTGGTAGG - Intergenic
1132712609 16:1276280-1276302 CACTCCCACCTCCCCTTGGTGGG + Intergenic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1133169410 16:3971930-3971952 CTGTCCCTCCTCTGCCTGGAGGG - Intronic
1133924455 16:10182105-10182127 CCCTCCCTCCCCTCGTTGGTGGG - Intronic
1135234646 16:20743804-20743826 CTCTCTCTCTTCTGCTGGCTGGG + Intronic
1135517647 16:23149090-23149112 CTCGCCCTCCTCTGCACGCTCGG - Exonic
1136061293 16:27728385-27728407 CTCTCCTTCCCCTGCTGGCTGGG - Intronic
1136559284 16:31029376-31029398 CTCTCCCACACCTGCTAGGTTGG - Intergenic
1138405308 16:56788207-56788229 CTCTCTCTCCTCTCCTGGGAGGG - Intronic
1139640866 16:68290558-68290580 CTCTCACTCCCCAGCTTGGCTGG + Intronic
1139847815 16:69933034-69933056 CTCTCCAGGCTCTGCTTGGTGGG + Intronic
1141995163 16:87632305-87632327 CCCACCCTCCTCTGCCTGGTGGG + Intronic
1142953782 17:3506202-3506224 CTCTCAGTCATCGGCTTGGTAGG - Intronic
1143592802 17:7895602-7895624 CTCTTACTCCTCTGTTTGTTGGG + Intronic
1145965502 17:28913879-28913901 CTCTTGCTGCTCTGCTTGGGTGG + Exonic
1146001288 17:29132072-29132094 CCCTCCCTCGGCTGCGTGGTTGG - Intronic
1146737653 17:35252849-35252871 CTCTCCCACTTCTGCTTGCCAGG + Intronic
1147120877 17:38334480-38334502 CTCTTCCTCCTCTTCTGTGTTGG + Intronic
1147214190 17:38889971-38889993 CTTGCTCTCCTCTGCATGGTCGG + Intronic
1147869598 17:43578155-43578177 CCCTCTCTCCTCTGCCTGGGGGG - Intronic
1148340651 17:46871611-46871633 CTCTACCTCCTAGGGTTGGTGGG - Intronic
1148553592 17:48564741-48564763 CCCTCCCTTCTCTGCCGGGTCGG - Intronic
1148984165 17:51607131-51607153 CTATCTCTCCTCTACTTTGTCGG + Intergenic
1149541937 17:57473993-57474015 TTCTCCCTCCTCTTCTTTATGGG + Intronic
1149572446 17:57682848-57682870 CTCACTCGCCTCTGCTTGGGAGG - Exonic
1150202512 17:63372034-63372056 CTCTCCCTCCTCCCCTTTGCTGG - Intronic
1150668007 17:67162875-67162897 CTCACCCTCCTCTACTATGTAGG - Intronic
1150961249 17:69914721-69914743 CTCTCTCTCATCTGATTGGCAGG + Intergenic
1151140812 17:71990506-71990528 CTCTCCTTCCACTCCTTGGTTGG + Intergenic
1153000093 18:447037-447059 CTCTGGCTCCTGTGCTTGGAGGG + Intronic
1153654916 18:7273715-7273737 CTCTCCCGCCACTGCTAGGCTGG - Intergenic
1155239758 18:23854072-23854094 CTCTCCTCCCTCTGCTCTGTTGG + Intronic
1156042491 18:32838267-32838289 CACTCCTTCCTCTGCTTTGTGGG + Intergenic
1156257279 18:35410237-35410259 TTTTCCCTCCTCTGCATGGCAGG - Intergenic
1156371011 18:36471182-36471204 CTCATGCTCCTCTGCTTTGTGGG - Intronic
1156497308 18:37534346-37534368 CTCTCCCTCTTCCTCTGGGTGGG + Intronic
1157216180 18:45785615-45785637 CTCTCCCTCCTGGGTTTGCTGGG - Intergenic
1157452631 18:47799869-47799891 CTTGCCCTCCTCTACTTTGTGGG - Intergenic
1157501069 18:48191127-48191149 CCCTCCCACCTCTGCAAGGTGGG - Intronic
1157756988 18:50227522-50227544 CTCTTCCTTCTCTGCTTCTTGGG + Exonic
1157815308 18:50725617-50725639 CTCCCCCACCTGTGCTTGCTGGG + Intronic
1159461378 18:68725659-68725681 CTCTCCCTCTTCTGCTTTTGAGG + Intronic
1160011514 18:75110052-75110074 CTCTCCCTCCTCCCCTGGCTTGG - Intergenic
1161565122 19:4997620-4997642 CCCTGCCTCCTCCGGTTGGTGGG + Intronic
1162424193 19:10584116-10584138 CTGTGCCTCCTCAGCGTGGTAGG - Intronic
1163899978 19:20092639-20092661 CTTTCCTTCCTCGGCATGGTTGG - Intronic
1167493897 19:49806974-49806996 CTCTCCCCTCTGTGCTTGGGGGG - Exonic
1168154748 19:54466553-54466575 CTCTTCCTCGTGTGCGTGGTGGG - Intronic
1168164097 19:54534584-54534606 CTCTCCCTTCCCTGCTTTATAGG - Intronic
1168264879 19:55217218-55217240 CTCTCCCGAGTCTGCTTTGTGGG - Intergenic
1168499986 19:56885218-56885240 CTACCCCTCCTCTGCTGGGGTGG + Intergenic
1168500429 19:56888324-56888346 CTACCCCTCCTCTGCTGGGGTGG + Intergenic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
925696311 2:6583534-6583556 CACTCCCTCCTCTGCTGGCGTGG - Intergenic
925746651 2:7049197-7049219 CTTACCCTCCTCTGCCTGGAAGG - Intronic
926219255 2:10924272-10924294 CTCTCCCTTCAATGCTTAGTAGG + Intergenic
927499053 2:23570252-23570274 CTTCCCCTCCTCTGCTTTCTGGG + Intronic
927510138 2:23639247-23639269 CTCTCTCTCATCTGTTTGGAGGG - Exonic
927640274 2:24841443-24841465 CTGTCCTTCCTCTGCTTTCTTGG - Intronic
928289195 2:30022825-30022847 CTCTCCCTCCTAGCCCTGGTTGG + Intergenic
929441362 2:41967766-41967788 CTCTCCGTCCTCTGCTTTTCAGG + Intergenic
929789865 2:45014307-45014329 CTCTCCCTCCTCTCCCTCCTGGG - Intergenic
931424973 2:62162511-62162533 CTCTCCCAACTCTGCATAGTGGG + Intergenic
933384869 2:81597361-81597383 CTTTCCCTGCTCTGCTCGGTAGG + Intergenic
933641457 2:84765599-84765621 CTTTTTCTCCTCTGCTTGTTTGG - Intronic
934713956 2:96532472-96532494 CTCTCCCGCCTCATCTTGGTGGG + Intergenic
936014110 2:108944725-108944747 AGCTCCCTCCTCTGCACGGTGGG - Intronic
936080899 2:109431978-109432000 CTCTTCCACCTCTGGTTGATTGG + Intronic
936851481 2:116904208-116904230 CTCTCCCTCCTTTCCTTCATGGG + Intergenic
936985081 2:118301681-118301703 CTCTACCTCCTTTCCTTGGCAGG - Intergenic
939398907 2:141666459-141666481 TTCTCCCTCCTCAGCTTCCTAGG + Intronic
940107553 2:150116127-150116149 CTTTCCCTCCTATGCATGGTTGG + Intergenic
942582179 2:177430571-177430593 CTCTCACTGCTCTGCTTGGCTGG + Intronic
942821139 2:180116927-180116949 ATCTCACTCCCCTGGTTGGTAGG + Intergenic
943423145 2:187695552-187695574 CTCTCCCTTCTCTGCTTTATTGG - Intergenic
944229819 2:197381240-197381262 CTCGACCTCCTGGGCTTGGTCGG - Intergenic
944542230 2:200765315-200765337 CTCCTCCTCCTCTGGTGGGTAGG + Intergenic
944921790 2:204421772-204421794 TTCTCCTTCCTCACCTTGGTTGG + Intergenic
945686151 2:212972719-212972741 CACTCCCTTCTCTGCCTGCTTGG + Intergenic
946033903 2:216726530-216726552 CTCTTCCTCCTCTACTAGTTGGG - Intergenic
947416882 2:229905782-229905804 CTCTCCTTGCTCTGATTGGTGGG - Intronic
947673768 2:231959888-231959910 CTCTGCCTCCTGTCCTTGCTGGG + Intergenic
948754640 2:240151736-240151758 CTCTCACACGTCTTCTTGGTGGG - Intergenic
948965056 2:241372753-241372775 CTCTCTTGCCTCTGCTGGGTGGG + Intronic
1170365993 20:15598936-15598958 CTCTCCCTCTTCTGCATAATAGG + Intronic
1170543073 20:17408280-17408302 CATTCCCTTCTCTGCTTGCTTGG - Intronic
1170893617 20:20395762-20395784 TTCACCCTCCTCTGCTAGGCAGG - Intronic
1171222981 20:23417839-23417861 CTCTGCCTTATCTGCTTGATAGG - Intronic
1171388479 20:24786253-24786275 CTTTCCCTCCTCTGCTTCGGTGG - Intergenic
1172195257 20:33087107-33087129 CTCACCCTCCTCTCCTTGCCTGG - Intronic
1172590624 20:36115285-36115307 ATCTCCAGCCTCTGTTTGGTAGG + Intronic
1173291366 20:41717875-41717897 CTCATCCTCCTCTGCTTGTCAGG + Intergenic
1174386095 20:50189451-50189473 CTTGCCCGCCTCTGCTGGGTAGG - Intergenic
1174414113 20:50356027-50356049 CTCTGCCTCTCCTTCTTGGTAGG - Intergenic
1175268286 20:57715546-57715568 CGCTCCTTGCTCTTCTTGGTAGG - Intergenic
1175310521 20:58008616-58008638 CTCCCACTGCTCTGCCTGGTGGG - Intergenic
1175715196 20:61250966-61250988 CTCTCCTTCTTCGGCTAGGTGGG + Intergenic
1176266384 20:64211629-64211651 CTCTCCCTTCCCAGCTTGGATGG - Intronic
1176302723 21:5106232-5106254 GGCTCCCGCCTCTGCCTGGTGGG - Intergenic
1176876095 21:14130693-14130715 CCATCCCTCCTCTGGCTGGTTGG - Intronic
1177142063 21:17368248-17368270 GACTCTGTCCTCTGCTTGGTGGG + Intergenic
1179579585 21:42332692-42332714 CTGAGCCTCCTCTGCTTGGGTGG + Intergenic
1179854301 21:44155691-44155713 GGCTCCCGCCTCTGCCTGGTGGG + Intergenic
1180747572 22:18101457-18101479 TTTTCCCTCAACTGCTTGGTGGG + Exonic
1181755076 22:25018033-25018055 CTCCTCCTCCTCTGCTTGGCTGG + Intronic
1183366901 22:37411640-37411662 CCCTACCTCCTATGCTGGGTGGG + Intronic
1184021943 22:41826808-41826830 CCTTCCCTCCTCTGCTTGGGAGG - Intergenic
1185214231 22:49589454-49589476 CTCTCTTTCCTCCGCTGGGTAGG - Intronic
949705169 3:6808111-6808133 CTCTCCCTCCTCTGCTTCCATGG - Intronic
949954708 3:9258276-9258298 CTTTCCCTCCCCTACTTGGGTGG - Intronic
950155185 3:10716586-10716608 CTCTTCCTCCTCCGGTTGGGAGG + Intergenic
953793227 3:45964431-45964453 CTCTCCCATGTCTGCTTGGGTGG + Exonic
954197777 3:49006669-49006691 GTCACCCTCCTCTTCTAGGTTGG + Exonic
954584457 3:51721260-51721282 CTCACCCTCCTCTCCTGGGCTGG + Intergenic
954687964 3:52380689-52380711 CTGTTCCTCCTGTGCATGGTGGG - Intronic
955592973 3:60557603-60557625 CTCTGCCTCATCTGCTTGCTTGG + Intronic
957534428 3:81483123-81483145 CTCTCCCTCATTTCCTTGTTGGG - Intergenic
958823465 3:99002609-99002631 CTCACCCACCTCTGCTAGGGTGG - Intergenic
960331566 3:116366279-116366301 CTCTCCTTGCTCAGTTTGGTAGG - Intronic
960488650 3:118283094-118283116 CTCTTTCTCCTCTGCTGGTTGGG + Intergenic
960621711 3:119643265-119643287 CTCTCCTTCATCTGTTTGGGAGG - Intronic
961198923 3:125028375-125028397 CTGTTCCTCCTCTCCTTTGTGGG + Intronic
962253537 3:133854458-133854480 CTCTCCCTCCTCGGCTGTGCTGG + Intronic
966600233 3:181767619-181767641 CTCTCCCTCCTACCCTTGGAAGG - Intergenic
967839263 3:193991635-193991657 ATATCCCTCCTCTGAGTGGTTGG + Intergenic
967991365 3:195133594-195133616 CTCGTCCGCCTCTGCTTGTTAGG - Intronic
968632126 4:1657150-1657172 CTCTCCCTCCTCAGCTGGTGGGG - Intronic
969705406 4:8788881-8788903 CTCTCCCTCCCCCGCTCTGTGGG - Intergenic
970435733 4:16033164-16033186 CTCTCTCTTTTCTGTTTGGTGGG + Intronic
974772320 4:66432921-66432943 ATCTCCCTCTTCTGCTCAGTAGG - Intergenic
975219836 4:71801423-71801445 CTCTGCCTCCTCGGCTCAGTGGG + Intronic
978777075 4:112515344-112515366 CTCCTCCTCCTCTTCTTCGTCGG + Exonic
979678578 4:123435451-123435473 CCCTCCCTTCCCTGCCTGGTGGG - Intergenic
981816733 4:148839651-148839673 CTCTCCCTCCTCTGCTTTCCTGG - Intergenic
983934628 4:173492745-173492767 CTCTCCCTCTTCAGCTGTGTAGG - Intergenic
985995413 5:3594832-3594854 CTCTCCATCCTCAGCCTCGTCGG - Intergenic
986815463 5:11404979-11405001 CTCTCCTTCCTCTGCCTCGCGGG + Intronic
988455230 5:31381634-31381656 CCATCCCTCCTCTGCCTGGATGG + Intergenic
989111145 5:37907604-37907626 CTCTCCACCCTCTGCTTCCTTGG - Intergenic
989387586 5:40868707-40868729 CTCTGCCTCCTCTGCCTCCTGGG + Intergenic
990040963 5:51378544-51378566 AACTCCCTCCCCTGCTTGGCTGG + Intergenic
990995443 5:61728397-61728419 CTCTCCCTGCTCTGCTTGAGGGG - Intronic
991139298 5:63220908-63220930 CTCTCCCTTCTCTTCTAGGCTGG + Intergenic
992120059 5:73583716-73583738 ATCTCCCTCCCCTGCCTGATTGG - Intergenic
993541310 5:89156212-89156234 CGCTCACCCCACTGCTTGGTGGG + Intergenic
993902398 5:93593535-93593557 CTCTCCCTCCTGTGGCTGCTTGG + Intronic
995047824 5:107670767-107670789 CTACCCCTCCCCAGCTTGGTGGG - Exonic
997460037 5:134045758-134045780 CTCTGCCTCCTCTGCTTCCCAGG + Intergenic
998288554 5:140888681-140888703 GTCTCTCTTCTCTGATTGGTAGG + Intronic
999252965 5:150193457-150193479 CTCTCCCTACCTTGCCTGGTGGG + Intronic
999385341 5:151150345-151150367 CTTTCCCTTTTCTGCTTTGTAGG + Intronic
999936335 5:156489975-156489997 CTCTCTCTTTTCTTCTTGGTTGG - Intronic
1001773638 5:174312998-174313020 CTCTTCCTCCTATACCTGGTGGG - Intergenic
1002518682 5:179777901-179777923 CTCTCCCTGCTTTGCTTTGCTGG + Intronic
1003026510 6:2559730-2559752 CTGTCCCTGCTCTTCCTGGTGGG + Intergenic
1005135966 6:22570069-22570091 CTCCGCCTCCTCCTCTTGGTCGG - Exonic
1005990286 6:30898003-30898025 CTCTCTCTCCTCTCCTGGATGGG + Intronic
1006913349 6:37578501-37578523 ATGTCCCTCCTCTGCTCGGCAGG - Intergenic
1007602180 6:43089374-43089396 TTCTCCCTCTTCTTCTAGGTGGG - Intronic
1007794532 6:44337147-44337169 CTTTGCCTCCTCTGTTTGGTTGG + Intronic
1009858635 6:69295593-69295615 CTCTCCTTCCTCTATTGGGTGGG - Intronic
1015514812 6:134073338-134073360 CTCTCCTTCACCTGCTTTGTTGG - Intergenic
1015732237 6:136360931-136360953 CGCACCCTCCTCTGCTGGGCTGG + Intronic
1017248595 6:152255668-152255690 CTCAGCCACCTCTACTTGGTTGG - Exonic
1017669510 6:156756609-156756631 CTCTCTCTCTTTTGCTTGGATGG - Intergenic
1019215782 6:170443077-170443099 CTGTGCCTGCTCTGCTTGGCAGG - Intergenic
1019597058 7:1863096-1863118 GGCTCCCTCCTCTGGTTGGGGGG - Intronic
1020154210 7:5709102-5709124 CTCTCCCTGCTCTTCTCGGGAGG - Intronic
1020215577 7:6187501-6187523 CTCCCCCTACTCTGCGTGGAGGG - Intronic
1021637548 7:22706930-22706952 CTTTCCTTCCTGGGCTTGGTTGG + Intergenic
1022834219 7:34098306-34098328 CTCTCCCTCCTGTGCATGGTGGG - Intronic
1023264510 7:38391958-38391980 TTCTCCTTCCTCTTCATGGTTGG + Exonic
1023539445 7:41249978-41250000 CTCTCCTTCCTCTGGAGGGTAGG - Intergenic
1023811826 7:43917854-43917876 CCCTCCCTCCTCAGCTTCCTGGG - Intronic
1024215658 7:47246162-47246184 CCATCCCTCCTCTCCTTGGTAGG - Intergenic
1024225935 7:47327040-47327062 TGCTCCCTCCTCTGCGTGGCTGG - Intronic
1026732166 7:72921445-72921467 CTCTGCCTCCTCAGCCCGGTGGG + Intronic
1026929692 7:74216995-74217017 CTCTCCCTTCTCTGATGGCTAGG - Intronic
1027420775 7:78015702-78015724 CTGTGCCTCCACTGCTTGGAAGG + Intergenic
1028058424 7:86277984-86278006 CTCTCTCTCCTCTAGTTGGTGGG - Intergenic
1028589671 7:92481805-92481827 CTTTCCCTCCTAGGCATGGTTGG - Intergenic
1029258474 7:99285360-99285382 CCCTCCCTCCTCTGTCTGCTAGG + Intergenic
1030182216 7:106721895-106721917 CTCTAGCTCCTCTGCCTGGCTGG - Intergenic
1030503030 7:110384077-110384099 CCCTTCTTCCTCTGCTTCGTAGG + Intergenic
1032516293 7:132508638-132508660 CTCTCCCACCTCCTCATGGTGGG - Exonic
1032579242 7:133088741-133088763 CTGTCCCTGCTCTACTTGGTGGG + Intergenic
1033552743 7:142462756-142462778 CTCACCCTCCGCTGATGGGTAGG + Intergenic
1033724229 7:144095828-144095850 TCCTCCCACCTCTGCGTGGTGGG + Exonic
1033736973 7:144232101-144232123 TCCTCCCACCTCTGCGTGGTGGG - Exonic
1033746084 7:144318845-144318867 TCCTCCCACCTCTGCGTGGTGGG + Exonic
1034405086 7:150897566-150897588 CTTTCCTTACACTGCTTGGTGGG - Intergenic
1034489908 7:151387596-151387618 CTCTCCTGCTTCTGCTTGGTTGG - Intronic
1035044716 7:155956101-155956123 CCCTCCCTGCTCTCCATGGTGGG + Intergenic
1035600014 8:891834-891856 CTCCCCCTCCTCGGCTGGCTGGG - Intergenic
1036372307 8:8172083-8172105 CTTTCCTTCCTGTGCATGGTTGG + Intergenic
1036638022 8:10564831-10564853 TTCTCTCCCCTCTGCCTGGTTGG - Intergenic
1036878595 8:12493558-12493580 CTTTCCTTCCTGTGCATGGTTGG - Intergenic
1037082073 8:14799642-14799664 CCCTCCTTCCTCTGCCTAGTAGG - Intronic
1037724005 8:21468134-21468156 CTCTCCCTCCTGGGCTAGTTAGG - Intergenic
1037737616 8:21580076-21580098 CTCTCCCTCTTCTCCTGTGTTGG + Intergenic
1037985538 8:23288524-23288546 CTGGCCCTTCTCTGCTTGGATGG + Exonic
1038803716 8:30771926-30771948 AACTCCCTCTTCTGCGTGGTCGG - Intergenic
1039558036 8:38490874-38490896 CTCTGCCTCCTCTGCCTCCTGGG + Intergenic
1041748398 8:61233806-61233828 CACTCCATTCTCTGCCTGGTGGG + Intronic
1041757719 8:61332295-61332317 TTCTTCCTCTTCTGCTGGGTGGG + Intronic
1042942624 8:74123126-74123148 CTCTATCTCCTCTGCTTGGCCGG + Intergenic
1043621084 8:82192642-82192664 GTCTGCCCCCTCTGCTTGCTGGG - Intergenic
1044374994 8:91459990-91460012 CTCTTTCTCCTCTGGCTGGTGGG + Intergenic
1044726290 8:95196690-95196712 CTCTCCCTCCTCACCTTGTCAGG - Intergenic
1047732922 8:127740852-127740874 CTTTTGCTCCTCTGCTTGGACGG - Exonic
1048081037 8:131127334-131127356 CTCTCCCTACTCTCCCTGGGTGG - Intergenic
1048623935 8:136163962-136163984 CTCTCACCTCTCTGCTTGGAGGG - Intergenic
1048944758 8:139434091-139434113 CTTTCCTTCCTCTCCTTGGCAGG - Intergenic
1049736924 8:144213147-144213169 CTCTCCCTTCTCTGCCTTCTTGG + Intronic
1050094310 9:2047533-2047555 CTCACCCCCCTCGGCTTGGGCGG - Intronic
1051143366 9:14002130-14002152 CTTAGCCTCCTCTGCTTGGCTGG + Intergenic
1053019441 9:34684844-34684866 CTTTCCCACCTCTGCCAGGTTGG + Intergenic
1053175200 9:35917562-35917584 GTCTCCCTCCACTGCTGGGATGG - Intergenic
1055822084 9:80277946-80277968 TTCTTCCTCCTCTGCTTAGTTGG + Intergenic
1057199488 9:93132657-93132679 CTCTCCAACCGCGGCTTGGTGGG + Intronic
1058417843 9:104806400-104806422 CTCTTCCTCCCCTGCCTGGCAGG + Exonic
1058933722 9:109748202-109748224 CTCTCCCTCCTTTGCATGCTTGG - Intronic
1060670226 9:125462257-125462279 GTCTCCCTGCTCTCCTTTGTTGG + Intronic
1061408162 9:130403940-130403962 TTCTCCCTTCTCTGCCTGGCAGG + Intronic
1061595149 9:131624094-131624116 CTCTTCCTCCTCGGCTTGGGAGG + Intronic
1061666584 9:132163583-132163605 CTCTCCCTCCTCGGCAGGGGCGG - Intronic
1061806600 9:133140637-133140659 CCCTCCCTGCACTGCATGGTGGG - Intronic
1186048002 X:5557040-5557062 CACTGACTCCTCTGCTGGGTTGG - Intergenic
1187127670 X:16469299-16469321 CTCCTCCCCCTCTGCTTGGGTGG - Intergenic
1187759043 X:22559438-22559460 CTCTCCCTCCTCTGGCTGGTGGG - Intergenic
1189232186 X:39461159-39461181 CTCTCCCACCTCTGCAGGATAGG - Intergenic
1192626915 X:72738505-72738527 GTCTCCCACCTCTGCTTCTTGGG - Intergenic
1192655319 X:72987316-72987338 GTCTCCCACCTCTGCTTCTTGGG + Intergenic
1193495961 X:82213283-82213305 CTCTCCCTCCTCCCTCTGGTAGG + Intergenic
1195472914 X:105253255-105253277 CTCTCCTTCCTTTTCTTGTTGGG + Intronic
1195642397 X:107190877-107190899 TTCTCCCTCCTCTGCTATTTAGG - Intronic
1197366251 X:125567610-125567632 CTGCCCCTCCTCTTCTTGGGTGG - Intergenic
1198130086 X:133685344-133685366 TTCTCTCTCTTCTGCTGGGTTGG - Intronic
1200374827 X:155768474-155768496 CTCTCTGTCCTCAGCTTGGGTGG - Intronic
1200397222 X:155998334-155998356 CTCCCCTTCCTCTGCTTGGCTGG - Intronic
1201147282 Y:11072231-11072253 CTTTCTCTCCTCTGCCTGGCTGG - Intergenic
1201474549 Y:14366373-14366395 CCCTCCCACCTCTGCTTCATGGG - Intergenic