ID: 1128638767

View in Genome Browser
Species Human (GRCh38)
Location 15:69320053-69320075
Sequence CACCCCAACGGGGAAGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128638767_1128638782 28 Left 1128638767 15:69320053-69320075 CCAGAGCCTTCCCCGTTGGGGTG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1128638782 15:69320104-69320126 TCACCTTCCATCAGCCTGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 387
1128638767_1128638777 3 Left 1128638767 15:69320053-69320075 CCAGAGCCTTCCCCGTTGGGGTG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1128638777 15:69320079-69320101 GGAACCCAACAGTCAGGGCCTGG 0: 1
1: 1
2: 1
3: 24
4: 168
1128638767_1128638776 -2 Left 1128638767 15:69320053-69320075 CCAGAGCCTTCCCCGTTGGGGTG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1128638776 15:69320074-69320096 TGAGGGGAACCCAACAGTCAGGG 0: 1
1: 0
2: 2
3: 12
4: 113
1128638767_1128638784 30 Left 1128638767 15:69320053-69320075 CCAGAGCCTTCCCCGTTGGGGTG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1128638784 15:69320106-69320128 ACCTTCCATCAGCCTGGCAGGGG 0: 1
1: 0
2: 1
3: 26
4: 211
1128638767_1128638775 -3 Left 1128638767 15:69320053-69320075 CCAGAGCCTTCCCCGTTGGGGTG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1128638775 15:69320073-69320095 GTGAGGGGAACCCAACAGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
1128638767_1128638783 29 Left 1128638767 15:69320053-69320075 CCAGAGCCTTCCCCGTTGGGGTG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1128638783 15:69320105-69320127 CACCTTCCATCAGCCTGGCAGGG 0: 1
1: 0
2: 5
3: 39
4: 436
1128638767_1128638781 24 Left 1128638767 15:69320053-69320075 CCAGAGCCTTCCCCGTTGGGGTG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1128638781 15:69320100-69320122 GGAGTCACCTTCCATCAGCCTGG 0: 1
1: 0
2: 2
3: 50
4: 690

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128638767 Original CRISPR CACCCCAACGGGGAAGGCTC TGG (reversed) Intronic
900180816 1:1310211-1310233 CACCCCAATAGGGGAGGTTCTGG - Intronic
900508990 1:3049300-3049322 CATCCCAACGGGCACGGTTCTGG + Intergenic
903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG + Intergenic
907810357 1:57863633-57863655 CACCCAATCTGGGAAGGCTACGG + Intronic
910232022 1:84997208-84997230 GACCCCAACTGGGGAAGCTCCGG - Intergenic
915797551 1:158752522-158752544 CACCCCAACTCGGAAGGCGCAGG + Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
921824179 1:219653276-219653298 CACACCAACTGTAAAGGCTCAGG + Intergenic
922405562 1:225309479-225309501 CTCCCCATCTGAGAAGGCTCAGG - Intronic
1065965819 10:30769550-30769572 CTCCCCAAGGGGTAGGGCTCTGG - Intergenic
1073125304 10:101145627-101145649 CACCCCAGGGCGGAAGGCTCAGG - Intergenic
1075007601 10:118842110-118842132 CACCCCAACTTGGAAGGGGCTGG - Intergenic
1076264310 10:129097920-129097942 CACCTCACCGGGGAAGGCCAGGG - Intergenic
1076275249 10:129192981-129193003 CTCCCCAACAGGGGAGGCACAGG + Intergenic
1083546990 11:63556322-63556344 CAAGCCAATGGGGAAGACTCAGG - Intronic
1083934205 11:65861956-65861978 CAGCCCAAAGCGGGAGGCTCTGG + Exonic
1084607482 11:70180991-70181013 GACCCCGATGGGGAAGGCTGAGG - Intronic
1084717734 11:70884182-70884204 CACCCCACCAGAGAGGGCTCGGG + Intronic
1084763862 11:71294762-71294784 CACCACATCTGGGAAGGTTCTGG + Intergenic
1085480514 11:76819245-76819267 GACCCCAAAGGGGGACGCTCCGG - Intergenic
1088797887 11:113279517-113279539 AGCCCGAAGGGGGAAGGCTCTGG - Intergenic
1092247942 12:6873597-6873619 CGCCCCCACGGCGAAGGCCCGGG + Intronic
1095254683 12:40020660-40020682 CACCTCAAAGGGGAAGGCACAGG - Intronic
1095704738 12:45224220-45224242 CATCCCAACAGGGCTGGCTCAGG - Intronic
1097938501 12:65278914-65278936 CACCCTAACGTGGCAGGGTCGGG - Intronic
1097954120 12:65465854-65465876 CACCCCAACGTGGAATCCTGGGG - Exonic
1103946611 12:124530937-124530959 CACCCCACCAGACAAGGCTCTGG + Intronic
1104489170 12:129179392-129179414 CTCCCAAACTGGGGAGGCTCTGG - Intronic
1105813775 13:24015705-24015727 CGCCCCAAAGGGGAAGGATCAGG - Intronic
1110853973 13:80277290-80277312 AACCCCAACAGGTTAGGCTCTGG + Intergenic
1121050796 14:90817673-90817695 CACCACAAGTGCGAAGGCTCTGG + Intergenic
1121119078 14:91364606-91364628 CACCCCAAGGGGGAGGGTTGGGG + Intronic
1122771376 14:104099426-104099448 CCCCCCCAGGGGGAAGCCTCAGG - Intronic
1123781654 15:23634323-23634345 CACCCCAGCAGGGAAGGTGCAGG - Intergenic
1124198567 15:27656578-27656600 CTCCCCATGGGGCAAGGCTCAGG - Intergenic
1126775938 15:52100564-52100586 CACCCCCACGGGAAAGCCCCAGG - Intergenic
1127007196 15:54583917-54583939 CACCCCCACGGGAAAGCCCCAGG + Intronic
1127502630 15:59569111-59569133 CACCCCCAAGAGGAAGGATCTGG - Intergenic
1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG + Intronic
1128638767 15:69320053-69320075 CACCCCAACGGGGAAGGCTCTGG - Intronic
1137609862 16:49811017-49811039 CAGCCCAGAGGGGCAGGCTCAGG + Intronic
1141700511 16:85640038-85640060 CAGCCCACCTGGGAAGGCTCTGG - Intronic
1142221800 16:88858714-88858736 CTCCGCAATGGGGAAGGCCCTGG + Exonic
1146414585 17:32620246-32620268 CAGCCCAGCAGGGAAGGGTCAGG + Intronic
1146656559 17:34638262-34638284 CCCCCCAACGGGGTCAGCTCGGG + Exonic
1148866171 17:50629842-50629864 AACCCCGAAGGGGAAGGCTGAGG - Intergenic
1149547777 17:57517261-57517283 CAGCCCAAAGGGGAAGGAGCAGG + Intronic
1151025313 17:70670521-70670543 CATCCTAACGGTGAAGGCTCAGG - Intergenic
1151930164 17:77227339-77227361 CACCCCACAGGGCAGGGCTCGGG - Intergenic
1154230636 18:12553135-12553157 CACCACAGCGGGGAAGGGGCTGG - Intronic
1157286100 18:46378494-46378516 CACCCAAACTGGAAAGGCTTCGG + Intronic
1158559857 18:58504900-58504922 CACCCCAAGGAGAAATGCTCAGG + Intronic
1160038518 18:75322353-75322375 CACTCCCACGGGGTACGCTCAGG - Intergenic
1160678187 19:401443-401465 CACCCCACGGGGGAAGGTGCGGG + Intergenic
1161206941 19:3046492-3046514 CACCCCAAAGGGCCAGGCTCTGG - Intronic
1162095952 19:8310029-8310051 CAGCTCAACGGGGAAGGCAGAGG - Intronic
1162581811 19:11536034-11536056 CCCCCCAACGGGGCAGCCCCGGG - Intergenic
1163719767 19:18893618-18893640 CACCCCAAAGGAGCAGTCTCTGG - Intronic
1164207110 19:23068261-23068283 CACCCCAGTGGGCAAGGCCCAGG + Intergenic
1164255409 19:23524035-23524057 CACCCCAGTGGGCAATGCTCAGG + Intergenic
1164489124 19:28690567-28690589 CACCCCAATGGGGAGGGGGCAGG - Intergenic
1165101199 19:33439626-33439648 CACCCCAGGTGGGAAGGATCCGG + Intronic
1166305735 19:41936072-41936094 CGCCCCAGCCGGGAAGCCTCAGG + Intergenic
1167080018 19:47271996-47272018 CACCCCAAGAGAGAAGGCCCAGG - Intergenic
1167538527 19:50070849-50070871 TACCACCATGGGGAAGGCTCAGG - Intergenic
1168118968 19:54241375-54241397 CACCTGAACGGGGAGGACTCAGG - Intronic
925172572 2:1759427-1759449 CTCCCCACAGGGCAAGGCTCAGG - Intergenic
928131839 2:28657457-28657479 CGCCCCATCTGGGAAGGCTCTGG - Intergenic
933049942 2:77590703-77590725 CTCCCCAAGGGGCAGGGCTCGGG + Intronic
938632031 2:133177860-133177882 CACCCCAACGGGGAATTGTTGGG - Intronic
1173498214 20:43534165-43534187 CTGCCCAAAGGGGAAGGCTAGGG - Intronic
1176671062 21:9735768-9735790 CTCCCCATGGGGCAAGGCTCGGG + Intergenic
1178605649 21:34034487-34034509 CACCCCAAAGGGTAAGGGACTGG + Intergenic
1180970425 22:19812106-19812128 CACCCCAAGGGGACAGGCCCAGG + Intronic
1182284980 22:29240907-29240929 CACTCCAACAGGTTAGGCTCTGG + Intronic
1183453101 22:37906977-37906999 CACCCCGAGTGGGAAGCCTCGGG - Intronic
1184054528 22:42035451-42035473 CACCCCAACTTGGAAGGGGCGGG + Intronic
1184511118 22:44933874-44933896 CACAACCACAGGGAAGGCTCTGG + Intronic
950498904 3:13351952-13351974 CTCCGCATCAGGGAAGGCTCAGG - Exonic
951024833 3:17817813-17817835 CTCCCCACCGGGCAGGGCTCGGG - Intronic
959863818 3:111243452-111243474 CACCCCAACTTGGAAGGGGCAGG + Intronic
961590388 3:127975232-127975254 CACCCAAAGGGTGAAGGATCTGG + Intronic
965310132 3:167116577-167116599 CACCGCAACAGGGAGGGTTCAGG - Intergenic
968359808 3:198138956-198138978 AGCCCCAACATGGAAGGCTCAGG + Intergenic
968510176 4:992097-992119 CTCCCCAACGGGGCAGGAACAGG + Intronic
968564829 4:1306071-1306093 CTCCCCAACGGGGAAGGCTGTGG + Intronic
970347172 4:15163667-15163689 TACCCCAGCTGGGAAGGCTTTGG - Intergenic
975888566 4:78995912-78995934 AAACCCAACGGGGAGGTCTCTGG - Intergenic
977380094 4:96262076-96262098 CACCTCAATAGGGAAGGCACTGG + Intergenic
987108671 5:14664760-14664782 CACCCCGACGGGAGGGGCTCCGG + Exonic
987798545 5:22662872-22662894 CTCCCCAACAGTGAAGGCTGAGG + Intronic
998079353 5:139261808-139261830 CAGCCCTACTGGGAAGCCTCTGG + Intronic
1000988877 5:167891357-167891379 CACTTCAACTGGGAAGGCTGAGG - Intronic
1002563913 5:180099641-180099663 CACCCCAGCAGGGGAGGCTCTGG - Intergenic
1006389834 6:33751806-33751828 CCACCCAACGGGGAAGGCACGGG + Intergenic
1006458774 6:34146027-34146049 CACCCCAGAGGGGGAGGGTCAGG + Exonic
1007392989 6:41561211-41561233 CTCCCCCACGGGGAATGCTGAGG + Intronic
1011044702 6:83068089-83068111 CGCCCCAGCAGGGGAGGCTCGGG - Intronic
1014790750 6:125669158-125669180 CTGCCCAACGGGGATGGCACTGG - Intergenic
1015913052 6:138187495-138187517 CATCCCAGCAAGGAAGGCTCCGG + Intronic
1016190569 6:141260636-141260658 CACCCCAACTCGGAAGGAACAGG - Intergenic
1019260179 7:77692-77714 AGCCCCAACATGGAAGGCTCAGG - Intergenic
1020551701 7:9615284-9615306 CACCACCATGGAGAAGGCTCGGG + Intergenic
1029250439 7:99232625-99232647 CAACCCAGCGGTGAAGGCTGTGG - Intergenic
1030835223 7:114276068-114276090 TATCCCAGCGGGGTAGGCTCTGG + Intronic
1040298069 8:46173555-46173577 CAGCCCAACTGGGAAAGCCCTGG - Intergenic
1045269926 8:100652919-100652941 CACCCCAACAGTCAAGGCTGTGG + Intronic
1049305033 8:141898190-141898212 CACCCCAACAAAGAAGGCTCTGG + Intergenic
1050052352 9:1616412-1616434 CACCCCAAGGCTCAAGGCTCAGG + Intergenic
1050130373 9:2406384-2406406 CACCCCAACTTGGAAGGGGCGGG - Intergenic
1050183188 9:2942514-2942536 CACCCCCACGGGAAAGCCTGTGG + Intergenic
1062471762 9:136709220-136709242 CACACCTTCGGGGCAGGCTCCGG - Intergenic
1062744513 9:138202777-138202799 AGCCCCAACATGGAAGGCTCAGG + Intergenic
1187054649 X:15731276-15731298 CACCCCAACAGGGAATGGTCTGG - Intronic
1192994494 X:76498593-76498615 CACCACAACCCAGAAGGCTCTGG - Intergenic