ID: 1128640022

View in Genome Browser
Species Human (GRCh38)
Location 15:69329095-69329117
Sequence CTTGTTCACCAGGCACTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128640018_1128640022 -3 Left 1128640018 15:69329075-69329097 CCTGGGAATGCGGCTTCGCCCTT 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1128640022 15:69329095-69329117 CTTGTTCACCAGGCACTGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 167
1128640017_1128640022 -2 Left 1128640017 15:69329074-69329096 CCCTGGGAATGCGGCTTCGCCCT 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1128640022 15:69329095-69329117 CTTGTTCACCAGGCACTGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 167
1128640016_1128640022 6 Left 1128640016 15:69329066-69329088 CCAGGTTACCCTGGGAATGCGGC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1128640022 15:69329095-69329117 CTTGTTCACCAGGCACTGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 167
1128640012_1128640022 17 Left 1128640012 15:69329055-69329077 CCGTCTGGACGCCAGGTTACCCT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1128640022 15:69329095-69329117 CTTGTTCACCAGGCACTGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128640022 Original CRISPR CTTGTTCACCAGGCACTGCA AGG Intronic
900992192 1:6103237-6103259 CTTCTGGACCAGGCAGTGCAGGG + Exonic
901090421 1:6637228-6637250 GTCCTTCACCAGGCACTGCAGGG + Exonic
901337776 1:8465970-8465992 CTTCTTCACCAGGCGCTGCAGGG + Exonic
901773627 1:11544104-11544126 CTTGTTCACAGGGCAATGCCAGG + Intergenic
902873662 1:19328576-19328598 CCTGTACACCAGGAACTGGATGG - Exonic
903793832 1:25913421-25913443 CTGGTTTACCAGGGACTGAAGGG + Intergenic
904478169 1:30777728-30777750 CTTGTTCACTGGCCACTGGATGG + Intergenic
910598905 1:89009598-89009620 CTTGACCACCAGGCACACCAGGG - Intronic
911294166 1:96093886-96093908 TATGTTCACCAGGCCCTTCATGG - Intergenic
912170980 1:107098776-107098798 CAGGGTCACCAGGCAGTGCAGGG - Intergenic
912372130 1:109181925-109181947 CTTTTTCTCCAGGCACCACATGG - Intronic
912480972 1:109981968-109981990 CTTGGAAACCAGCCACTGCAGGG - Intergenic
912553007 1:110496626-110496648 CTGGTCCACTAGGCACTCCATGG + Intergenic
913145293 1:115983540-115983562 CTCGTTCAGCAGGCCCTGTAAGG + Intronic
916560500 1:165930755-165930777 ACTGTTCACCAGGGGCTGCAGGG - Intergenic
918582270 1:186145420-186145442 CATGTTCCCCAGCCACTCCAAGG - Exonic
920537564 1:206748794-206748816 CTTGGTGACCAGGCACTGATGGG - Intergenic
922889998 1:229054615-229054637 CTTGTTCACTGGACTCTGCAAGG - Intergenic
1064547829 10:16468589-16468611 ACTGTGTACCAGGCACTGCAGGG + Intronic
1064607728 10:17061323-17061345 CTTGTTCGCCAAGCAATTCAAGG - Intronic
1069841773 10:71344252-71344274 GTTGGCCACCAGGCACAGCATGG - Exonic
1070895883 10:79982538-79982560 GCTGATCACCAGGCATTGCATGG - Intronic
1075139637 10:119819845-119819867 ATTGTTTAACAGGTACTGCAGGG - Intronic
1075230183 10:120669643-120669665 CTGGTTTACCAGGCTCTGCAAGG + Intergenic
1075892024 10:125960359-125960381 CTGCTCCACCAGGCGCTGCAGGG + Intronic
1076053878 10:127355785-127355807 CATGCTCTCCAGCCACTGCAGGG - Intronic
1076508663 10:130996832-130996854 CATGTTCTCCAGGGCCTGCAGGG + Intergenic
1077186275 11:1236781-1236803 CAAGTTCACCAGGCACTGCCTGG + Intronic
1081298286 11:41419227-41419249 CTTGTTCATCAGGAGCTGTATGG - Intronic
1081570707 11:44289104-44289126 CTTGTTTCCCAGACACGGCAGGG + Intronic
1081731976 11:45378061-45378083 CTTGGGCACCAGGAACTGCCAGG - Intergenic
1083191763 11:61057209-61057231 CCTGTTTCCCAGGAACTGCAGGG - Intergenic
1084089113 11:66868920-66868942 CCTGTCCACCAGGAACTCCACGG + Exonic
1084149474 11:67281464-67281486 CTTTTTGTCCAGGCACTTCATGG - Exonic
1088069728 11:105767264-105767286 CTTGTTCCCTAGGAAATGCATGG + Intronic
1088384878 11:109242539-109242561 CTTTTTCACCACACACTGTATGG - Intergenic
1089671428 11:120059748-120059770 TTTGTTCATCAGCCATTGCAAGG + Intergenic
1092407441 12:8230743-8230765 CTTTTCCACCAGACCCTGCATGG - Intergenic
1094785279 12:33841476-33841498 GTTGTTCTCAGGGCACTGCATGG + Intergenic
1096271499 12:50169016-50169038 CCTGTGTGCCAGGCACTGCATGG + Intergenic
1099347492 12:81520873-81520895 CTGGGCTACCAGGCACTGCATGG - Intronic
1100642074 12:96491610-96491632 CTAGTACACCAGGCACTTAATGG - Intronic
1100922168 12:99500355-99500377 TTTGCTCTCCAGGCACTGCTTGG - Intronic
1101592322 12:106135868-106135890 CTGAGTCACCAGGCACTGTATGG + Intronic
1101981027 12:109406963-109406985 CTAGCTCACCAGGCCCTGCGTGG + Intronic
1103273163 12:119690151-119690173 CTTGTTCACCTGGGACAGCGGGG + Exonic
1103303028 12:119942584-119942606 CTTGCTGTCCAGGGACTGCAGGG + Intergenic
1103448531 12:121011002-121011024 CTTGTTCACCTGGAAATGCCAGG + Intronic
1104736826 12:131140143-131140165 CCTGGACACCAGGCACTGCGGGG - Exonic
1104842929 12:131833208-131833230 CATGTCCCTCAGGCACTGCAAGG - Intronic
1108911284 13:55554827-55554849 TGTTTTCAACAGGCACTGCAGGG - Intergenic
1110514194 13:76389758-76389780 GTTGTCCACCAGGCTCTGTATGG + Intergenic
1110834282 13:80065954-80065976 CTTGTTTACCAGGGGCTGCCAGG + Intergenic
1111182973 13:84693383-84693405 ATTGTTCATCAAGCAATGCATGG - Intergenic
1112643480 13:101304032-101304054 CTTGTTCATCAACCAATGCAGGG + Intronic
1113038207 13:106074530-106074552 CTTGTGCCCCAGCCACTGCGTGG - Intergenic
1114050380 14:18916202-18916224 CTTGTTGACCACGCGGTGCAGGG + Intergenic
1114112178 14:19485730-19485752 CTTGTTGACCACGCGGTGCAGGG - Intergenic
1115633446 14:35267931-35267953 CTTGTCTACCAGGATCTGCAAGG - Intronic
1117982726 14:61357930-61357952 TCTGGTCACCAGGCAGTGCAAGG - Intronic
1118242881 14:64078661-64078683 CTTGTTCATCAGTCACCACAGGG + Intronic
1120032518 14:79658704-79658726 CTTGTGGGCCAGGCACAGCAAGG - Intronic
1121845669 14:97169990-97170012 CTTCCTCACCAGGCTCTGCAGGG - Intergenic
1122847298 14:104506871-104506893 CTTGTTCTCCAGGCAGGGCCTGG - Intronic
1127409039 15:58686436-58686458 CTGCTCCACCAGGCACTGCAGGG - Intronic
1128640022 15:69329095-69329117 CTTGTTCACCAGGCACTGCAAGG + Intronic
1133111101 16:3548811-3548833 CTTGGTCACCAGGGATTCCAGGG + Intronic
1133439157 16:5806168-5806190 TTTCTTCACCAGCCACTGGAGGG + Intergenic
1141398728 16:83727806-83727828 TTTGCTCACCAGTCACAGCAGGG + Intronic
1141999974 16:87658711-87658733 CTTCTTGACCACCCACTGCAGGG - Intronic
1143958192 17:10691782-10691804 CTATTTCACAAGGCACTGTAAGG + Intronic
1143985041 17:10905834-10905856 CATGTTTACCAGGGGCTGCAGGG - Intergenic
1145314479 17:21721231-21721253 CTTGCTCTCCAGCCACTGGAAGG + Intergenic
1145883434 17:28367648-28367670 CTTGTGCACCAGGGACAGCAAGG + Intronic
1146651117 17:34607006-34607028 CTTGTGCAGAAGGCTCTGCATGG + Intronic
1148863249 17:50615419-50615441 CTTGTGCACCAGCCACTACCTGG + Exonic
1149400830 17:56294247-56294269 CTTGATTACCAGCCACTGGAGGG - Intronic
1149536180 17:57435376-57435398 CTGGTTCACAAGGCTCTGCGTGG - Intronic
1154295033 18:13140165-13140187 CCTGTTCACCAACCACTGGAAGG - Intergenic
1160803792 19:982688-982710 CTCGTTCACACGGCCCTGCACGG + Intergenic
1162322672 19:9979167-9979189 CTTGTTCACCAGGAGGTCCAGGG + Exonic
1164630254 19:29757457-29757479 CACGTCCCCCAGGCACTGCATGG - Intergenic
1165055406 19:33173396-33173418 CTGCTTCACCAGGCACAGCTGGG + Intronic
1165093477 19:33398182-33398204 CTTGGTCAGCAGGCAGTGCCGGG - Intronic
925046859 2:778745-778767 CTGGGACACCAGGCACTCCAGGG + Intergenic
925780363 2:7376380-7376402 CTTGGTCTGCAGGCACAGCAGGG - Intergenic
925883420 2:8371296-8371318 CTTGTTCAACAATCACTGCCAGG - Intergenic
927147175 2:20173791-20173813 GTTGATGACCAGGAACTGCATGG + Intergenic
928891308 2:36206191-36206213 CTTGTTCAGGCGGCAGTGCATGG - Intergenic
931813186 2:65874652-65874674 TGTGTTCACCATGCACTACATGG - Intergenic
938297664 2:130188495-130188517 CTTTTTCACGAGTCACTGCTGGG + Intronic
938459108 2:131486171-131486193 CTTTTTCACTAGTCACTGCTGGG - Intronic
941460879 2:165770135-165770157 CTTTATCACCAGGCTTTGCAGGG - Intronic
941616345 2:167724941-167724963 CATGTTCTCCAAGCACTGAATGG - Intergenic
943178351 2:184508122-184508144 AGTGTTTACCAGGGACTGCAGGG - Intergenic
1168963808 20:1886737-1886759 CTTAGTAAACAGGCACTGCAGGG - Intergenic
1169673489 20:8130439-8130461 CTTGTTCACCAGGTTATCCATGG + Intergenic
1169955310 20:11096398-11096420 CTTGTTCCCCAGAATCTGCATGG - Intergenic
1171190509 20:23156028-23156050 CTTTCCCATCAGGCACTGCATGG + Intergenic
1176000267 20:62828497-62828519 CTCGTCCACCAGGCACATCATGG - Intronic
1176412715 21:6457680-6457702 CTTGTGTGCCAGGCACTGCCAGG + Intergenic
1177803504 21:25851050-25851072 CTCATTCCCCAAGCACTGCAAGG + Intergenic
1178744147 21:35231260-35231282 CTTGTTCACCAGGAAGTTTAAGG + Intronic
1179688209 21:43066002-43066024 CTTGTGTGCCAGGCACTGCCAGG + Intronic
1180468856 22:15638576-15638598 CTTGTTGACCACGCGGTGCAGGG + Intergenic
1180713273 22:17854509-17854531 CCTGTTCACCAGGCAGTTCTCGG - Intronic
1180792822 22:18586015-18586037 GTTGTTCACCAGGCACAGGTGGG - Intergenic
1181228914 22:21409304-21409326 GTTGTTCACCAGGCACAGGTGGG + Intergenic
1181249737 22:21525561-21525583 GTTGTTCACCAGGCACAGGTGGG - Intergenic
1181602006 22:23958363-23958385 CTTGTCCTCCAGCCATTGCAGGG + Exonic
1181606503 22:23982944-23982966 CTTGTCCTCCAGCCATTGCAGGG - Exonic
1183248339 22:36710953-36710975 CCTGGTCACCAGGCCATGCAGGG - Intergenic
1184249119 22:43250272-43250294 CTTGATCAGCAGACACTGCCTGG - Intronic
1184484394 22:44767386-44767408 CATGTTCAGCAGGGACTGCTGGG - Intronic
952827466 3:37536290-37536312 CTCATTCACCAGGCATTCCATGG - Intronic
952888142 3:38024413-38024435 CCGGATCCCCAGGCACTGCATGG + Exonic
952919631 3:38275793-38275815 CTTGGTCAGCAGTCACAGCAGGG - Intronic
952968515 3:38636402-38636424 CTTCTTCACCAGGCCTTGGATGG - Intronic
953879269 3:46683277-46683299 GCTGTTCACCAGGCCCTGCATGG - Exonic
955767713 3:62362235-62362257 CTTCTTAACCACGCACTGTATGG + Intergenic
958698453 3:97556461-97556483 CTTCTTCACATGGCACAGCAAGG + Intronic
960054415 3:113266904-113266926 CTTAATCACCAGGCACTCCTAGG + Intronic
960547151 3:118928561-118928583 GTTGTTGACCAGGCACTGGTAGG + Exonic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961447918 3:126989744-126989766 CTTGTTGAGCAGCCACGGCAGGG - Exonic
962352394 3:134665359-134665381 CTTGTGCAACAGCCACTCCAGGG - Intronic
965145766 3:164900909-164900931 CTTGAGCACCAGACACAGCACGG + Intergenic
967154725 3:186681898-186681920 CTTCTTCTCCAGGGACTCCAGGG + Intergenic
968430959 4:558550-558572 CATGTCTGCCAGGCACTGCAGGG - Intergenic
970994587 4:22250755-22250777 CTTGTGAAACAGGCACTTCATGG - Intergenic
973035653 4:45402989-45403011 CTTGGTCACTAGGCACTACTGGG + Intergenic
974409918 4:61526649-61526671 CTTGATTACCTGGGACTGCAGGG - Intronic
977417729 4:96755973-96755995 CTTCTTTAACAGGCACTGCCTGG - Intergenic
977736241 4:100419896-100419918 CCTGCTCACCATGCATTGCATGG - Intronic
978413177 4:108447125-108447147 CTTGTTCACCAGGATGTGCATGG - Intergenic
980097887 4:128512114-128512136 GTACTTCAGCAGGCACTGCAGGG - Intergenic
984024232 4:174523297-174523319 CTTGCTCTCCAGGAACTCCAGGG + Intergenic
985352984 4:189086082-189086104 CTCTTCCTCCAGGCACTGCAGGG + Intergenic
985528476 5:420127-420149 CTTCTCCTCCAGGAACTGCACGG - Intronic
985878828 5:2621874-2621896 CTTGCCCACCAGGCACAGCGAGG + Intergenic
986067144 5:4245733-4245755 CTTGTTCTGCAAGCACTGCCTGG - Intergenic
987403511 5:17502160-17502182 CTTGCGCACCAGGCGCTGGAAGG + Intergenic
987410988 5:17614900-17614922 CTTGCGCACCAGGCGCTGGAAGG + Intergenic
990372961 5:55139403-55139425 CCTGTTCAGCAGGCTCTGAAAGG + Intronic
992537498 5:77723658-77723680 TTTATTTTCCAGGCACTGCAAGG + Intronic
994277947 5:97862265-97862287 CTTTTTAACCAGTCTCTGCATGG + Intergenic
995131896 5:108639466-108639488 GTAGGTCACCAGGCACTGCAGGG - Intergenic
997681081 5:135751116-135751138 CTAGTTCACCAGCCAGTGCACGG - Intergenic
1001079785 5:168659168-168659190 CTTATTTACCAGTCCCTGCAGGG - Intergenic
1003608302 6:7585468-7585490 CTTGTTGACCCGGAAGTGCATGG + Exonic
1003906476 6:10704755-10704777 CTTCATCTCCAGCCACTGCAAGG - Exonic
1004325637 6:14671740-14671762 CTCACACACCAGGCACTGCAGGG - Intergenic
1005726340 6:28652393-28652415 CTTATTCACTAGACACTGAATGG - Intergenic
1007328572 6:41084120-41084142 CTTGTCCACCAGGGACAGCCTGG - Exonic
1009494155 6:64328261-64328283 ATTGTTCTCCAGCCACTGGAAGG - Intronic
1015423530 6:133038450-133038472 CTTTTTCACTTGGCAATGCAAGG + Intergenic
1015525169 6:134168789-134168811 CTTCTTCATCAGGCTCTGGAAGG + Intergenic
1018907281 6:168082910-168082932 GTTCTTCCCCAGGCACTGCAGGG + Intergenic
1019783351 7:2957960-2957982 CTTGATCTTCAGGCCCTGCAAGG + Intronic
1020114722 7:5470175-5470197 CATCTTCCCCAGGCTCTGCAAGG + Intronic
1024532655 7:50406380-50406402 CCTGTTCACCTGGCCCTCCATGG + Intergenic
1029172964 7:98643776-98643798 CTTCTCCACCTGGCACAGCAGGG - Intergenic
1029519663 7:101052034-101052056 CTTGGTCTCCAGGCAATGCCTGG - Intronic
1029537816 7:101166321-101166343 CTTTTTCTCCAGACACAGCACGG - Intergenic
1033923966 7:146433769-146433791 CATTTGCACCAGGCAATGCATGG - Intronic
1038418910 8:27419498-27419520 CTCCTGCACCAGGCACTGCTAGG - Intronic
1039385690 8:37133844-37133866 TTTTTTCACCAGGGACTTCAGGG - Intergenic
1042509351 8:69594958-69594980 CATGTCCACCAGGCACTGGGAGG - Intronic
1044752250 8:95427647-95427669 AATGTTCTCCATGCACTGCAAGG + Intergenic
1046997315 8:120538504-120538526 CTTGTTCACCAGGTACGCAAGGG - Exonic
1048038542 8:130701805-130701827 CTTGTTCCCATGGCACTGCTGGG - Intergenic
1050033043 9:1406333-1406355 CTTGATCTCCAGGCCCTGCCTGG + Intergenic
1050336242 9:4592570-4592592 GTTCTTCACCAGGCATTGTAAGG + Intronic
1058424874 9:104867729-104867751 CATATCCACCAGTCACTGCAAGG + Intronic
1062181191 9:135192103-135192125 CTTTATCACCAGGACCTGCAGGG + Intergenic
1062400296 9:136369861-136369883 CTTCTCCTCCATGCACTGCAGGG + Exonic
1190739748 X:53281202-53281224 CTTGTGTGCGAGGCACTGCAGGG - Intronic
1192767963 X:74161910-74161932 CTTGGTCACTGGGCCCTGCAAGG + Intergenic
1196433329 X:115651641-115651663 CTTGTTAAAGAGGCACTTCAAGG - Intergenic
1196592871 X:117508271-117508293 CTTGGTCATCAGGCACTACTTGG + Intergenic