ID: 1128643548

View in Genome Browser
Species Human (GRCh38)
Location 15:69358478-69358500
Sequence CACCAGAGGCTGCCCCTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 1, 2: 4, 3: 44, 4: 368}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128643548_1128643559 24 Left 1128643548 15:69358478-69358500 CCGTCCAGGGGCAGCCTCTGGTG 0: 1
1: 1
2: 4
3: 44
4: 368
Right 1128643559 15:69358525-69358547 CCCTGCTGCGGTGCGGCCTTGGG 0: 1
1: 1
2: 0
3: 8
4: 146
1128643548_1128643553 12 Left 1128643548 15:69358478-69358500 CCGTCCAGGGGCAGCCTCTGGTG 0: 1
1: 1
2: 4
3: 44
4: 368
Right 1128643553 15:69358513-69358535 AGCAGCCCAGCTCCCTGCTGCGG 0: 1
1: 1
2: 4
3: 54
4: 417
1128643548_1128643557 23 Left 1128643548 15:69358478-69358500 CCGTCCAGGGGCAGCCTCTGGTG 0: 1
1: 1
2: 4
3: 44
4: 368
Right 1128643557 15:69358524-69358546 TCCCTGCTGCGGTGCGGCCTTGG 0: 1
1: 0
2: 3
3: 9
4: 216
1128643548_1128643555 17 Left 1128643548 15:69358478-69358500 CCGTCCAGGGGCAGCCTCTGGTG 0: 1
1: 1
2: 4
3: 44
4: 368
Right 1128643555 15:69358518-69358540 CCCAGCTCCCTGCTGCGGTGCGG 0: 1
1: 0
2: 4
3: 26
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128643548 Original CRISPR CACCAGAGGCTGCCCCTGGA CGG (reversed) Intronic
900090735 1:919332-919354 CACCTGAGGCTGCCTGTGCAGGG + Intergenic
900112480 1:1014354-1014376 CTCCAGGGGCTTCCCCTCGAAGG - Exonic
900360082 1:2284163-2284185 CCCCAGAGGCCGGCCCTGGGGGG + Intronic
900402590 1:2478684-2478706 CATCAGTGGCTGCCCTGGGAGGG - Intronic
900551617 1:3259273-3259295 CCCCAGCTGCAGCCCCTGGAGGG - Intronic
900582334 1:3415331-3415353 CGCCATGGGCTGCACCTGGAGGG + Intronic
900637205 1:3671813-3671835 CAGCAGTGGCTGCCTCTGGAAGG + Intronic
901927797 1:12578006-12578028 GACCCGTGGCTTCCCCTGGAGGG - Intronic
901931066 1:12596264-12596286 GAGGAGAGGCTGCCCCCGGAGGG - Intronic
902050437 1:13560179-13560201 AACCAGAGACTGTCCCCGGAAGG - Intergenic
902362236 1:15948198-15948220 CTGCAGGTGCTGCCCCTGGAGGG + Intronic
902797304 1:18807977-18807999 TTCCCTAGGCTGCCCCTGGAAGG + Intergenic
902931795 1:19736605-19736627 CAGCAGGGGCTGCCTGTGGAGGG - Intronic
903222362 1:21875956-21875978 CACCAACGGCTGCCCGTGCAGGG + Exonic
903261015 1:22131949-22131971 CAGCAGAGGCTGCATTTGGAAGG + Intronic
903996368 1:27307555-27307577 CCCCAGGGGCTGCAGCTGGAGGG - Exonic
904596897 1:31652466-31652488 CACCAGAGGAACCCACTGGAAGG + Exonic
904821351 1:33246609-33246631 TAGCAGAGGCTTCCCTTGGAGGG - Intergenic
905794341 1:40807211-40807233 TCCCTGAGGCTGTCCCTGGAGGG - Intronic
905919036 1:41707135-41707157 CCCCCGGGGCTGCCCCTTGAAGG + Intronic
906507845 1:46393453-46393475 AACCAGAGACTGCCCCTGAAGGG + Intergenic
906510996 1:46410478-46410500 CACCAGAGGCTTCACCAGGAAGG - Exonic
907751469 1:57267537-57267559 CTCCAGAGGCTGCCCTTGGGAGG - Intronic
907883509 1:58572898-58572920 GACCTGGGGCTGCCCTTGGAAGG - Intergenic
907909648 1:58815072-58815094 CCCCAAAGGCAGCCCCAGGACGG + Intergenic
908428392 1:64031408-64031430 CCCCAGAAGCTGACCCTGGGGGG - Intronic
909147059 1:71948706-71948728 CACTAGATGCTGCTGCTGGATGG - Intronic
909643856 1:77895004-77895026 CACTATAGGCTGGCCATGGATGG - Intronic
909869590 1:80722784-80722806 CTCCACAAGCTGCCCCTGGAAGG - Intergenic
910520903 1:88121272-88121294 CAGGAGAGGCTTCTCCTGGATGG - Intergenic
910567571 1:88662464-88662486 CACCAGAGACTAGGCCTGGAAGG - Intergenic
910629290 1:89339734-89339756 TACCAGTGGATGACCCTGGATGG + Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
916069278 1:161160612-161160634 CACCACAGGCTGGACCTGGGAGG - Exonic
916723795 1:167505073-167505095 CACCAGAGGAAGCCCTTGGAAGG - Intronic
917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG + Intergenic
920067915 1:203282194-203282216 CAGCACAGGGTGCTCCTGGATGG + Intergenic
920093697 1:203472071-203472093 CCACAGAGGCTGGCCCTGGACGG - Intergenic
921384676 1:214556637-214556659 CACAGGAGGCTGCCTCTGGCGGG + Intergenic
922782441 1:228263896-228263918 CACCAAGGGCTGCCCCAGGCAGG - Intronic
1065810533 10:29438798-29438820 AACCAGAGACCGGCCCTGGAAGG + Intergenic
1067224703 10:44368084-44368106 AACCTGTGGCTGCCCATGGAGGG - Intergenic
1068143048 10:53029564-53029586 CGCCAGAGGCTCCCACTGCATGG - Intergenic
1069704753 10:70451281-70451303 CACCAGTGACTCCCCGTGGAGGG - Intergenic
1069729275 10:70600630-70600652 CGCCAGAGGCAGGCGCTGGAGGG + Exonic
1069769291 10:70887664-70887686 CTCCAGAGCCGGCACCTGGAAGG - Intronic
1070823739 10:79379231-79379253 CACAGGAGGCAGCCCCTGGAAGG + Intergenic
1071559280 10:86632556-86632578 CCCCTGAGGCTGGCCCTGCAGGG - Intergenic
1072750076 10:97972123-97972145 AACCAGGGGCTGCCCCAGGCTGG - Intronic
1073070195 10:100788433-100788455 GACCAGAGGCTGCCACTGCCTGG + Intronic
1073147198 10:101288643-101288665 CAGCAGAGGCTGTCCCTCCAGGG + Intergenic
1073179448 10:101574984-101575006 GGCCCGAGGTTGCCCCTGGAGGG - Intronic
1073486164 10:103820416-103820438 GACCAGATGCAGCCCCTGGCAGG - Intronic
1074536084 10:114329461-114329483 CACCAGCAGCTGCCCCTGGTGGG + Intronic
1075275246 10:121086951-121086973 CCCTAGAGGTTGCCCCTAGAGGG + Intergenic
1075603040 10:123784698-123784720 CACCAGAGGCTGCTTCGTGAGGG - Intronic
1075701558 10:124473121-124473143 AACCAGAGGCAGCACCTGCAGGG - Intronic
1076410083 10:130242777-130242799 CACCACAGGCTTCCCCAGGAGGG - Intergenic
1076692939 10:132233037-132233059 CACCAGAAGCTCCCCCAGGAAGG - Intronic
1077051774 11:569767-569789 CACCTGTGGCTGCCTGTGGATGG + Intergenic
1077156116 11:1092482-1092504 CCCCACAGGCTTCCCCAGGATGG - Intergenic
1077429920 11:2511293-2511315 AGCCAGAGGTTGCCACTGGAGGG + Intronic
1078022401 11:7666578-7666600 AACAAGAGGATGGCCCTGGAGGG - Intronic
1078135415 11:8648036-8648058 AACCAGAGGATGCTTCTGGAAGG - Exonic
1078758707 11:14234635-14234657 CACCGGAGGCAGCCCTTGGGCGG + Intronic
1079081347 11:17415506-17415528 CAGCAGAGGCTTCCCCAAGATGG - Intronic
1082241277 11:49873783-49873805 CACCAGAATCAGCCACTGGAAGG - Intergenic
1082608007 11:55265674-55265696 CACCAGAATCAGCCACTGGAAGG + Exonic
1083125269 11:60559438-60559460 CAACAGAGGCTGCCTTTGGAGGG - Intergenic
1083996630 11:66276275-66276297 CTCCAGATGATGTCCCTGGAGGG + Exonic
1084872950 11:72109978-72110000 CCCCAGATCCTGCCCCTGGCTGG + Exonic
1084940083 11:72607766-72607788 GAGCAGAGGCTGCCCTTGGCCGG + Intronic
1085464839 11:76716445-76716467 CTCCAGAGGCTGCATGTGGATGG - Intergenic
1085665923 11:78416460-78416482 CACCAGTGGCTGTCCATGGGGGG - Intronic
1086113171 11:83220082-83220104 CACCAGAGGCTCCCCCTGCATGG - Intronic
1086442863 11:86846589-86846611 TGCCAGAGGCTCCCCCTGCATGG + Intronic
1086462526 11:87019675-87019697 CACTGGAGGTTGCCCCTGAAGGG - Intergenic
1086695946 11:89845538-89845560 CACCAGAATCAGCCACTGGAAGG + Intergenic
1086702599 11:89916918-89916940 CACCAGAATCAGCCACTGGAAGG - Exonic
1086703568 11:89927532-89927554 CACCAGAATCAGCCACTGGAAGG + Intergenic
1086710209 11:89998945-89998967 CACCAGAATCAGCCACTGGAAGG - Intergenic
1087128657 11:94650669-94650691 CACCAGAGAGTGGCCCTGGCTGG - Intergenic
1088811080 11:113392976-113392998 CAACAGAGGCTAGCTCTGGAAGG + Intronic
1089494051 11:118899620-118899642 CACCACTGGCTTCCCCTGGCTGG + Intronic
1089625872 11:119750521-119750543 GAGCAGAGGCTGCATCTGGATGG + Intergenic
1089706916 11:120284657-120284679 CAGGAGAGGCAGCCCCAGGATGG - Intronic
1089968296 11:122671964-122671986 CACCAGCCGCTGCCCCAGAATGG + Intronic
1091083117 11:132691588-132691610 CACCAGGTGCTGTCACTGGATGG - Intronic
1091353410 11:134915491-134915513 CACAAGAGGCTGCTCCTGGAGGG - Intergenic
1091801432 12:3327031-3327053 CACCAGAGGGTGCCACGGGAGGG + Intergenic
1091926405 12:4354430-4354452 CTGCAGTGGCTGCCTCTGGAGGG - Exonic
1096678148 12:53236679-53236701 CACCTGGGACTTCCCCTGGATGG + Intergenic
1098956871 12:76696949-76696971 TGCCAGAGGCTCCCCCTGCATGG - Intergenic
1099369395 12:81811629-81811651 GACCAGAGGGAGCCCCTGGGGGG + Intergenic
1099422063 12:82473546-82473568 CCCTACAGGCTGCCCCTGGAGGG - Intronic
1100187105 12:92150507-92150529 CAACTGAGGCGGGCCCTGGAGGG + Intergenic
1100245466 12:92752605-92752627 CACCTGAGGATGGCCCTGAAGGG + Intronic
1100852634 12:98729145-98729167 TAGCAGAGGCTTCACCTGGAGGG + Intronic
1102605569 12:114064982-114065004 AACCAGAGACCACCCCTGGAGGG - Intergenic
1103567331 12:121823198-121823220 CAGCAGGGGCCGCCCTTGGAAGG + Exonic
1103764354 12:123270765-123270787 CCCCAAGGGCTGGCCCTGGAAGG - Intronic
1103955763 12:124575957-124575979 CAGCAGAGGTTGCCTCTGGGTGG + Intergenic
1104409691 12:128547774-128547796 CACCAGCGGCTTCCCCAGGCAGG + Intronic
1104769026 12:131348914-131348936 TACCAGAGGCTGACATTGGAGGG + Intergenic
1111770030 13:92585096-92585118 CACTAGATGGTGCCCCAGGAGGG - Intronic
1113030836 13:105991981-105992003 GCCCAGTGGATGCCCCTGGAAGG - Intergenic
1113048519 13:106183110-106183132 CACAAGAAGCTGTCCCTAGAAGG + Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1117135507 14:52730717-52730739 CACCAGACGCTGCCCCTCCGCGG - Intronic
1117179927 14:53181333-53181355 AACCAGAGACCACCCCTGGAGGG + Intergenic
1118098680 14:62569805-62569827 CACAAGAGAATGTCCCTGGAAGG + Intergenic
1118320212 14:64748523-64748545 CACCACAGGCGGTCCCAGGAAGG - Exonic
1118877083 14:69794860-69794882 CACCAGAGGCTCTGCCTGGGTGG + Intronic
1121274017 14:92655832-92655854 CCCCAGTGCCTGCCCCAGGATGG - Intronic
1121636204 14:95455441-95455463 CTGCAGAGGCTGGCCCAGGAGGG - Exonic
1121940403 14:98064768-98064790 GAGCAGAGGCTGCCCCAAGAGGG - Intergenic
1122488539 14:102097549-102097571 AACCAGAGGTTGCCCTTGGGGGG - Intronic
1122541471 14:102499952-102499974 CAGCAGAGGCAGCCCCAGGCCGG + Exonic
1122828492 14:104383766-104383788 GAGCAGATGCTGCCCTTGGAAGG - Intergenic
1122987608 14:105219763-105219785 CACCAGGGGCAGCCCCTCGAGGG - Intronic
1123000841 14:105293261-105293283 CACCTGGCGCTGGCCCTGGAGGG - Intronic
1123028058 14:105437888-105437910 GCCCAGAGGCTTACCCTGGAAGG - Intronic
1124139756 15:27067160-27067182 CCCCAGATGCTCCCACTGGAGGG - Intronic
1125854195 15:42933430-42933452 ACCCAGAGGCTCCTCCTGGAAGG + Intergenic
1128144497 15:65325206-65325228 CTCCCCAGGCTGCCCTTGGATGG + Intergenic
1128153024 15:65375326-65375348 CACTATAGGCTGCCCGGGGACGG + Exonic
1128643548 15:69358478-69358500 CACCAGAGGCTGCCCCTGGACGG - Intronic
1128735876 15:70053655-70053677 CTCCAGAGGCCCACCCTGGAGGG - Intronic
1130148290 15:81292212-81292234 CAGCTGTGGCAGCCCCTGGAGGG + Intronic
1132051803 15:98613657-98613679 TCCCAGGGGCTGCCCCTTGATGG - Intergenic
1132208211 15:100001055-100001077 CACCAGAAGGTGCTCTTGGATGG + Intronic
1132348106 15:101120830-101120852 AACGGGAGGCTGGCCCTGGAGGG - Intergenic
1132679117 16:1132546-1132568 CAGCAGACGCTCCCCCAGGACGG - Intergenic
1132746601 16:1438812-1438834 CACCTCATGCTGCCCCTGCAGGG + Exonic
1132913139 16:2326125-2326147 GAACAGAGGCAGCTCCTGGATGG + Exonic
1133110242 16:3543714-3543736 AAATAGAGGCTGTCCCTGGAAGG + Intronic
1133315959 16:4884222-4884244 CACCGGCGGCAGCTCCTGGAGGG - Exonic
1133377449 16:5299093-5299115 GAACAGTGGTTGCCCCTGGAAGG - Intergenic
1133907018 16:10031670-10031692 CACCAGAGGATGCTTCTGGAAGG + Intronic
1134207921 16:12252782-12252804 CACCAAAGGCTCCCCATGGCTGG - Intronic
1136014002 16:27383402-27383424 CACCAAAGGTGTCCCCTGGAGGG - Intergenic
1136025323 16:27464813-27464835 CACCTGATGCTGCTCCAGGAGGG + Exonic
1136106418 16:28033388-28033410 CACCAGCGGTTGCCCCTGGGAGG + Intronic
1136110605 16:28062257-28062279 CAGCCCAGGCTGCCTCTGGAGGG + Intronic
1136687520 16:32003914-32003936 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1136788133 16:32947465-32947487 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1136881652 16:33906324-33906346 CACCAGAGGCAGGCTCAGGAGGG - Intergenic
1137231237 16:46569553-46569575 CACCAGAAGCTGCGCTGGGAGGG - Intergenic
1138117826 16:54374402-54374424 GACCACATGCTGCCCCTGGAGGG - Intergenic
1139422439 16:66856923-66856945 CACCACTGGCTGCCCAGGGAGGG - Intronic
1139438142 16:66948613-66948635 ACCCAGAGGCTGCCCCGGGTCGG - Intergenic
1139958153 16:70703080-70703102 CACCAGGGGCTGTCCCTGCCCGG + Intronic
1203090358 16_KI270728v1_random:1209122-1209144 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1142574075 17:894695-894717 CTGCAGAGGCTGCCCCCGGCAGG - Intronic
1144488450 17:15686905-15686927 TCCCACAGGGTGCCCCTGGAAGG - Intergenic
1144912563 17:18695400-18695422 TCCCACAGGGTGCCCCTGGAAGG + Intergenic
1145296052 17:21593363-21593385 CCCCAGAAGCTGACCCTGAAGGG + Intergenic
1145367742 17:22278698-22278720 CCCCAGAAGCTGACCCTGAAGGG - Intergenic
1146467070 17:33094677-33094699 AACCATGGGCTGCCCCTGCAGGG - Intronic
1147148501 17:38499583-38499605 CACCAGAGGCAGGCTCAGGAGGG + Intronic
1147661520 17:42119508-42119530 CCCCCGAAGCTGCCCCTGGCTGG + Intronic
1148189975 17:45671721-45671743 TACCATAGGCAGCCCTTGGAGGG + Intergenic
1148752110 17:49951396-49951418 CTCCAGATGCGGCCCCTGCAAGG + Intergenic
1148821261 17:50360942-50360964 CAGCATACCCTGCCCCTGGATGG + Exonic
1148829897 17:50424933-50424955 CACCGGAGGCTGGGCCTGCAAGG - Intergenic
1151311213 17:73293465-73293487 GACCAGAGGCTGCCCCTGGAAGG - Intronic
1151416628 17:73970519-73970541 CAGCAGAGGCTGCATCAGGAGGG - Intergenic
1151901745 17:77020447-77020469 CCCCTCAGGCTGCCCCTTGAGGG + Intergenic
1152080409 17:78183881-78183903 CTCGAGAGGCTGCCCTTGCAGGG - Intronic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1152719209 17:81914688-81914710 CACCACATGCTGCACCTGGAAGG + Exonic
1153560127 18:6363278-6363300 CATCAGGGGCTGCCCCTGGACGG - Intronic
1154567255 18:15914390-15914412 GAACAGTGGTTGCCCCTGGAAGG + Intergenic
1154591532 18:16246285-16246307 GAACAGTGGTTGCCCCTGGAAGG + Intergenic
1154605101 18:16431909-16431931 GAACAGTGGTTGCCCCTGGAAGG + Intergenic
1156202658 18:34852300-34852322 CACCAGAGAGGCCCCCTGGAAGG + Intronic
1156448622 18:37254115-37254137 CGCCAGCGCCTGCCCCCGGAGGG - Intronic
1156703940 18:39857337-39857359 CAGCACAGGCTCCTCCTGGAAGG + Intergenic
1158183523 18:54745090-54745112 CAGCAGACGCAGCTCCTGGAAGG - Intronic
1158560147 18:58506613-58506635 CCCCAACGGCTGACCCTGGAAGG - Intronic
1159623763 18:70669150-70669172 CAGCTGAGGCTGCACCTGGGAGG - Intergenic
1159874952 18:73800626-73800648 CAGCAGAGGCAGCAGCTGGACGG + Intergenic
1160232577 18:77058979-77059001 CCCCTGAGGCTGCCCCAAGATGG + Intronic
1160328238 18:77969406-77969428 CACCAGCATCTGCCCCTGGGAGG - Intergenic
1160328255 18:77969470-77969492 CACCAGCATCTGCCCCTGGGAGG - Intergenic
1160328272 18:77969534-77969556 CACCAGCACCTGCCCCTGGGAGG - Intergenic
1160328306 18:77969668-77969690 CACCAGCACCTGCCCCTGGGAGG - Intergenic
1160328315 18:77969700-77969722 CACCAGCATCTGCCCCTGGGAGG - Intergenic
1160328325 18:77969732-77969754 CACCAGCACCTGCCCCTGGGAGG - Intergenic
1160543355 18:79637765-79637787 ACCCAGAGGCAGCCCCTGGCCGG - Intergenic
1161200607 19:3012720-3012742 TAACAGAGCCTGCCCCTAGATGG - Intronic
1161575171 19:5051027-5051049 CACCTGTGGCAGCCCCTGCAGGG + Intronic
1161925106 19:7294046-7294068 GCCCAGAGGCAGCCCCGGGAAGG + Intergenic
1162426923 19:10602575-10602597 CAGCAGAGGCGGCCCCTGACCGG - Intronic
1163927548 19:20360451-20360473 AACCAGAGACCACCCCTGGAGGG - Intergenic
1165893576 19:39128732-39128754 GGACAGAGGCTGCCCCTGGAAGG - Intronic
1166069293 19:40377933-40377955 CACCAGGGGCGGCCCCCCGAGGG + Intronic
1166298001 19:41898001-41898023 GCCCCGAGGCTGCCCCGGGAAGG - Intronic
1166300115 19:41908354-41908376 GTCCAGAGGCTGCCCTTGGTGGG - Intronic
1167116837 19:47493332-47493354 CACCAGAGGACTCCCCTGGTGGG + Intronic
1167299555 19:48670992-48671014 CAGCAGAGCCAGCACCTGGAGGG + Exonic
925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG + Intergenic
925386714 2:3467056-3467078 AGCCAGTGGCTCCCCCTGGAAGG - Intronic
926121308 2:10242649-10242671 GACCAGAGGAAGCTCCTGGAGGG - Intergenic
926206139 2:10835423-10835445 CCCCGGAGGCCGCACCTGGAAGG - Intronic
926427767 2:12754900-12754922 CTCCTGGGGCTGACCCTGGAAGG + Intergenic
927040505 2:19226057-19226079 CACCAGAGGCAGGCCTGGGATGG + Intergenic
928438202 2:31269675-31269697 GTCCTGAGGCAGCCCCTGGAGGG + Intergenic
929979192 2:46663111-46663133 AACCAGAGCCTGCCTCTGCAAGG - Intergenic
931697025 2:64879023-64879045 CACCAGAGGCAGAGCATGGAAGG + Intergenic
932302449 2:70676770-70676792 GAGCAGAGGCTGCCCCTGACTGG - Intronic
932460534 2:71879272-71879294 CACCACTCCCTGCCCCTGGAGGG + Intergenic
932674913 2:73771297-73771319 CACAAGAGGCTGCCTCTCCATGG + Intronic
933812919 2:86044345-86044367 CATCAGAGGCTGCCCTGGGGAGG - Intronic
934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG + Intronic
935754264 2:106264946-106264968 CACAGGAGGCTGCCCCTGTCAGG + Intergenic
936008389 2:108909574-108909596 CACTGCAGGCTGCGCCTGGAAGG - Intronic
936802409 2:116284820-116284842 TACCAGATGCTACCCCTTGAGGG + Intergenic
937345878 2:121124986-121125008 CACCAGAGGAGGACCCTGCATGG + Intergenic
937419044 2:121739407-121739429 GCCCAGAGGCTCCTCCTGGAAGG + Intronic
937982664 2:127624454-127624476 AAACAGAGGCTGGGCCTGGAAGG - Intronic
938092085 2:128440803-128440825 CCACAGAGGCTTCCCCTGGTGGG + Intergenic
939884295 2:147664458-147664480 CCCCAGAGGCAGCCCCTGAAAGG - Intergenic
942135349 2:172919664-172919686 AAACTTAGGCTGCCCCTGGAAGG - Intronic
943041554 2:182811169-182811191 CACAGCAGGCTGCCCCTGCATGG - Intergenic
944264010 2:197705190-197705212 CGCCAGAGGCCGCCAATGGACGG - Intronic
944269061 2:197760456-197760478 CCCCACAGGCTGCCTCTGGTGGG + Intronic
944592833 2:201234008-201234030 ACCCAGGGGCTGCTCCTGGAAGG - Intronic
947315971 2:228858823-228858845 AAACAGAGGGTGCCTCTGGAGGG - Intronic
947637456 2:231687412-231687434 CTCCAGTGGCTGGGCCTGGAGGG - Intergenic
948233577 2:236370258-236370280 CACCCCAGGCTGCACCTGCACGG - Intronic
948811026 2:240478516-240478538 AGCCACAGGCTGCCCCTGGGAGG - Intergenic
948829454 2:240591065-240591087 TACCATGGGCTGCCCCAGGAGGG + Intronic
1170480655 20:16761861-16761883 CACCCCATGGTGCCCCTGGAGGG - Intronic
1170792976 20:19522764-19522786 CAGGAGAGGCTGCTCCTGCAGGG + Intronic
1171986861 20:31666668-31666690 CACCAGAGGCTCCCTCCAGAGGG - Intronic
1172361097 20:34312885-34312907 CTCCAAATCCTGCCCCTGGAGGG - Intergenic
1172587985 20:36098157-36098179 CACGACAGCCTGGCCCTGGAAGG + Intronic
1173581753 20:44151942-44151964 AACCAGAGGTGGCCCCTGCAGGG + Intronic
1173865191 20:46308533-46308555 CACCAGAGGCTGCGGGAGGAAGG - Intergenic
1174019864 20:47521244-47521266 AACCAGAGACCGCCCCCGGAGGG + Intronic
1174079757 20:47962590-47962612 CACCTGCAGCTGCCTCTGGAAGG + Intergenic
1175733740 20:61371355-61371377 CACCAAGGGCTGCCCCAGGAAGG - Intronic
1176215977 20:63947942-63947964 CCCCAGAGGCTGCCCCTCCCAGG - Intronic
1176874457 21:14114547-14114569 CTCCAGCAGCTGCCTCTGGAGGG + Intronic
1179504027 21:41828165-41828187 CACCAGCGCCGGCACCTGGAAGG - Exonic
1180905349 22:19406753-19406775 GAGCAGAGGCTGCCCCAGGTGGG + Intronic
1181079868 22:20406753-20406775 CACCAGAGGCTGCACAGCGAGGG + Exonic
1181482814 22:23211831-23211853 CACCAGCCCCTACCCCTGGAGGG - Intronic
1181682302 22:24503899-24503921 AACCAGGGGCTGCCCCAGGCTGG + Intronic
1181787599 22:25238260-25238282 AACCAGGGGCTGCCCTAGGAGGG - Intergenic
1181819340 22:25463298-25463320 AACCAGGGGCTGCCCTAGGAGGG - Intergenic
1182861240 22:33561278-33561300 AACCAGGGGCTGCCCCAGGCTGG + Intronic
1183367137 22:37412798-37412820 TGCCAGAGGCTGGACCTGGAGGG - Intronic
1183489980 22:38110981-38111003 CAGCAGCAGCAGCCCCTGGAGGG + Intergenic
1183620301 22:38968205-38968227 AACCAGAAGGAGCCCCTGGAGGG - Intronic
1183831621 22:40421124-40421146 AGCCTGAGGCTGCCCCTGAATGG - Intronic
1184090697 22:42291601-42291623 CAGCAAAGGCAGCCCCTGCATGG + Intronic
1184114447 22:42414233-42414255 CACCAGAGGGGAGCCCTGGAGGG - Intronic
1184125062 22:42481153-42481175 CTGCAGAGGCTGCACTTGGATGG + Intergenic
1184665447 22:45986674-45986696 CACCAGAGGTGGGCCCTGGATGG + Intergenic
1184674073 22:46030829-46030851 CAGTAGAGCCTGCCCTTGGAAGG - Intergenic
1184984644 22:48121463-48121485 GAGCAGAGGCTGCACCTGAATGG + Intergenic
1185045705 22:48527739-48527761 CGACAGAGGCTGACCCAGGAAGG - Intronic
950435381 3:12976262-12976284 CAGCAGTGGCCGCCCCAGGAGGG + Intronic
950438709 3:12994913-12994935 TAGCAGAGGCTGGGCCTGGAAGG + Intronic
950525171 3:13519025-13519047 TCCCCGAGGCTGACCCTGGAGGG + Intergenic
950846924 3:16023696-16023718 AACCAGAGGCTGCCCTCAGAGGG + Intergenic
951962994 3:28349246-28349268 CACCAGAGGGCGCCCCTGAAGGG - Intronic
953454187 3:43029119-43029141 CACCTGAAGCTGCTGCTGGAGGG - Intronic
953970096 3:47340511-47340533 CAAGAGAGGCTGCTCCAGGAAGG + Intronic
953988249 3:47462488-47462510 CATCAGAGGCAGCCACTGAAAGG + Intronic
954388182 3:50255277-50255299 CAGCAGAGGCAGGCCCTGCAGGG + Intronic
954864497 3:53717462-53717484 CACCAGATGGTGGCCCTGGGTGG + Intronic
955372568 3:58366335-58366357 CACCAGAAGCTGCCCATGAGTGG - Intronic
956284017 3:67589659-67589681 CAGCAGATGCTTCCCTTGGAAGG - Intronic
957136384 3:76294258-76294280 CAGCTGCAGCTGCCCCTGGAAGG + Intronic
957445245 3:80308031-80308053 TGCCAGAGGCTCCCCCTGCAGGG + Intergenic
957916761 3:86695938-86695960 CACCAGAGGCTCCCCCTGCAGGG - Intergenic
960809507 3:121614484-121614506 CCCCTGAGGCTGCCACGGGAAGG - Intronic
961168788 3:124781183-124781205 CACCAGAGCCAGACCCGGGATGG + Intronic
961332211 3:126149088-126149110 CACCAGAAGCTGCCTTTGGACGG + Intronic
961343308 3:126244890-126244912 CACCAGTGACTGACCCTGGTTGG - Intergenic
961548925 3:127655887-127655909 AGTCAGAGGCTGACCCTGGAAGG + Intronic
961765526 3:129207563-129207585 CTCCAGAGGCTGCCTTTGCAAGG + Intergenic
962375463 3:134855357-134855379 GACCAGAGGCAGCCCATGCAGGG - Intronic
962876904 3:139542078-139542100 CACCAGGGGCTGTGCCTGGGAGG - Intergenic
963078249 3:141368025-141368047 CACCAGGAGCTGCCCGGGGATGG + Intronic
963264455 3:143227124-143227146 TACCTGCAGCTGCCCCTGGAAGG + Intergenic
964223033 3:154368157-154368179 CGCCAGAGGCTCCCCCTGCAAGG + Intronic
964341498 3:155713321-155713343 CTCCAGAGGCTCCTGCTGGAGGG - Intronic
964721238 3:159768912-159768934 GAGCAGGGGCTGCCCATGGAAGG - Intronic
964917246 3:161852949-161852971 CGCCAGAGGCTCCCCCTGCATGG - Intergenic
965233205 3:166080524-166080546 GAACAGTGGCTGCCACTGGAAGG - Intergenic
965241485 3:166205140-166205162 GACCAGAGACAGCCACTGGAAGG - Intergenic
966274501 3:178149365-178149387 CACCAGATGATGACACTGGAGGG - Intergenic
967805758 3:193713414-193713436 GACCATATGCTGGCCCTGGAAGG - Intergenic
967954998 3:194871271-194871293 CATCAGAAGCAGCCCCTGGGAGG - Intergenic
968175954 3:196549605-196549627 CACCTGAAGGTGCCCCTGTAGGG - Intergenic
968612992 4:1565464-1565486 CAGGTGAGGTTGCCCCTGGAGGG + Intergenic
968744574 4:2353023-2353045 CCACAGAGGCTGTCCCTGGAGGG + Intronic
968884601 4:3320963-3320985 GAGCAGAGGAGGCCCCTGGAGGG + Intronic
969363066 4:6677455-6677477 CTGCAGAGGCCGCCCGTGGATGG + Intergenic
969537967 4:7768339-7768361 GACCGGAAGCTGCCCCAGGAGGG + Intronic
969564122 4:7967611-7967633 CACCAGGGGCTTCCGGTGGAGGG - Intronic
970108961 4:12616553-12616575 CTCCAGAGTCTGCCCCTGCTGGG + Intergenic
975879265 4:78883953-78883975 CTCCAGAGGCTGAGCCTGGGAGG + Intronic
979633407 4:122929134-122929156 CACAAGAGGCTGGACCTGGATGG - Exonic
980439237 4:132818377-132818399 AACCAGAGACTGTCCCCGGAGGG + Intergenic
980593397 4:134921704-134921726 CACCAGACTCTGCACCCGGAAGG - Intergenic
983534118 4:168839319-168839341 CACCAGATGGTGCCCCTGTTGGG + Intronic
985716729 5:1467178-1467200 CACCTGTGGCTGCCACTGGGAGG + Intronic
985785021 5:1888843-1888865 CTCCAGGGGCTCCCCCGGGAAGG + Intergenic
985967937 5:3351918-3351940 AACCTGAGGCTGCCCCTGCTTGG - Intergenic
986462023 5:7982406-7982428 CAGCTGAGGCTGACCCTGGAAGG + Intergenic
986532370 5:8751870-8751892 CACCAGAGCCTGCCTCAGGGTGG + Intergenic
993786109 5:92139299-92139321 CACCAGAGGCTTCTCCAGTACGG - Intergenic
995845169 5:116486091-116486113 CACCAGAATCTGACTCTGGAAGG - Intronic
997267051 5:132501080-132501102 AGCCACAGGCTGCCCCAGGAAGG + Intergenic
997834809 5:137183669-137183691 CACTAGAGGCAGCCCAGGGAAGG + Intronic
999444752 5:151630484-151630506 GACCAGTGGCCACCCCTGGAAGG + Intergenic
1000405931 5:160888492-160888514 CACCAGCGGCAGACCCTGGGTGG - Intergenic
1002834482 6:854461-854483 AACCAGTGACTGCCCCTGGCAGG - Intergenic
1002869947 6:1157581-1157603 AACCAGGGGCAGCCCCTGGTTGG + Intergenic
1004517433 6:16332286-16332308 CACCAGAGGGCGCCCCAGGATGG + Intronic
1006451751 6:34109423-34109445 CTCCAGAGGCAGCCCCTGCAGGG - Intronic
1007575367 6:42922239-42922261 CACCAGAGGCTGCCACAACAGGG + Intronic
1008845285 6:55955882-55955904 CACCAGAAGCTGTCCTTGCAAGG - Intergenic
1011450265 6:87484264-87484286 AACCAGAGACCGCCTCTGGAGGG + Intronic
1011569996 6:88725150-88725172 AACCAGAGACCGCCCCGGGAAGG - Intronic
1013297077 6:108767193-108767215 ATCCAGAGGCTGCTCCTGAAAGG + Intergenic
1014201949 6:118618151-118618173 CACCAGAGGCTCCCACAGCATGG + Intronic
1015114741 6:129635485-129635507 CGGCAGAGGCTGGCCCTGCATGG + Intronic
1017631354 6:156398968-156398990 CACCCCTGCCTGCCCCTGGATGG + Intergenic
1018998650 6:168729198-168729220 CACCAGAGGCTGAGCGTGGCAGG - Intergenic
1020066313 7:5190661-5190683 CACCCGAGGGTCTCCCTGGAGGG - Intronic
1020104869 7:5418064-5418086 CACCCTAGGCTGGCCCTGGAGGG - Intronic
1021178527 7:17478838-17478860 CAGCAGAAGCTTCCCCTGTAAGG - Intergenic
1021838371 7:24702883-24702905 GAACAGAGCCAGCCCCTGGATGG + Intronic
1022088141 7:27088412-27088434 CACCAGCGCCTGCCCCCGGCCGG - Intergenic
1023207869 7:37770444-37770466 CATCTGAGCCTGCCCTTGGATGG + Intronic
1023704327 7:42925074-42925096 GACAAGCGGCTGCCCTTGGATGG - Intronic
1023850111 7:44145786-44145808 AACGAGAGGCCGCCGCTGGAGGG - Intronic
1023887817 7:44373703-44373725 CAGCTGAGGCTGTCCCTAGAAGG + Intergenic
1023968748 7:44976991-44977013 TACCAGGAGCTGCCCCTGTATGG - Exonic
1024009718 7:45257309-45257331 CACTTGAAGCTGCCCATGGAGGG + Intergenic
1024246565 7:47475452-47475474 CACCAGAGGCCGCCACCAGAAGG + Intronic
1027529059 7:79307433-79307455 CACCAGAGGCTTTCCCTAGAAGG + Intronic
1027687382 7:81294798-81294820 CACCCATGGCTGCGCCTGGATGG - Intergenic
1028001226 7:85500865-85500887 CATCAGAAGCTGTCCATGGAGGG - Intergenic
1030362008 7:108605165-108605187 AACCAGGGGCTGCCCCAGGCTGG + Intergenic
1031079179 7:117241687-117241709 AACCAGTGCCAGCCCCTGGAAGG - Intergenic
1032513725 7:132491960-132491982 CACCCCAGGCTGCCCTTGGAAGG - Intronic
1033424392 7:141230860-141230882 CAGCAGAGGCTGAACCTTGAAGG + Intronic
1033610763 7:142961470-142961492 GAAGAGAGGCTGCCCGTGGAAGG - Exonic
1034274838 7:149819545-149819567 CCCCAGGCTCTGCCCCTGGAAGG + Intergenic
1034435744 7:151062073-151062095 CACCCAAGGCTGCCCAGGGAGGG - Intronic
1034475941 7:151282076-151282098 CCCCAGAGGCTGCCAGTTGAGGG - Intergenic
1034907350 7:154962026-154962048 CACCAAAGGCGGCCCCTGTTGGG - Intronic
1035022299 7:155806904-155806926 TCCCAGAGGGTGCCCCTGGAGGG - Intronic
1035072988 7:156158440-156158462 CAACATGGGCTGGCCCTGGAGGG - Intergenic
1036658285 8:10691639-10691661 CAGCAGAGGCTGCCCATTGAGGG - Intronic
1037125257 8:15340551-15340573 CACCAGACGCTGCGAATGGAAGG - Intergenic
1037754743 8:21703457-21703479 CACCACAGGCTCTCCCTGGGTGG + Intronic
1038267557 8:26048108-26048130 CAGCGGCGGCTGCGCCTGGAGGG + Intergenic
1038778883 8:30554292-30554314 CACCAAATGCTACCACTGGAAGG + Intronic
1039079648 8:33722406-33722428 CGCCAGAGGCTGCCCATAGCAGG + Intergenic
1039130856 8:34262534-34262556 CTCCTGAGGCTGGTCCTGGATGG + Intergenic
1039891380 8:41687978-41688000 CACCATTGGCTGCCCATGAAGGG - Intronic
1040871022 8:52100448-52100470 CAGCAGAGGCGGCTCCGGGAAGG - Intergenic
1042025636 8:64420732-64420754 AACAAGAGGATGCTCCTGGATGG - Intergenic
1042741324 8:72050277-72050299 CACCAGCTGCTTCCCATGGATGG - Intronic
1044668606 8:94655947-94655969 CTCCAGAGGCTGAAGCTGGAGGG + Intronic
1044848871 8:96408530-96408552 CAGCTGAGGCAGTCCCTGGAGGG - Intergenic
1044950993 8:97435173-97435195 GCACAGAGGCTGCTCCTGGAGGG - Intergenic
1045929586 8:107606040-107606062 CGCCAGAGGCTCCCCCTGCACGG - Intergenic
1046229539 8:111335276-111335298 CACAAGCGGCTGCTCGTGGAGGG - Intergenic
1046678535 8:117139817-117139839 CAACAGAGGCTGCGCATGCAGGG + Intronic
1047003152 8:120593308-120593330 CATGCGAGGCTGCCACTGGATGG - Intronic
1048780004 8:137990103-137990125 CGTCAGAGGCTCCCCCTGCATGG + Intergenic
1049246730 8:141566875-141566897 CAGCAGACGCTGCCCCCGGAGGG + Intergenic
1049254700 8:141607619-141607641 CACCAGATGCTGGGCCTGGATGG - Intergenic
1049614889 8:143571807-143571829 CACCAGAGCATGCACCTGGTGGG + Exonic
1056070648 9:82983457-82983479 CCCCAGTGGCTACACCTGGAAGG - Intronic
1056310890 9:85339848-85339870 GACAGGAGGCTGGCCCTGGATGG - Intergenic
1056472430 9:86918917-86918939 GACCTGGGGCTGACCCTGGAAGG + Intergenic
1056594773 9:87998034-87998056 CAGCAGGGGCTGTCCCTGGGTGG - Intergenic
1056724631 9:89103881-89103903 TACCAGAGGCTGCCTCTGTCAGG + Intronic
1057470066 9:95349432-95349454 CACCTGGGGCTGCCTCTGCAGGG - Intergenic
1059324914 9:113498154-113498176 CACCAAATGCTGCCCCTTTAGGG - Intronic
1060652155 9:125337501-125337523 CACCAATGGCTGCAGCTGGAGGG - Exonic
1060661900 9:125409359-125409381 CACCCCAGGGAGCCCCTGGAGGG + Intergenic
1060794493 9:126504796-126504818 GACCCGAGGATGCCCCTGGTGGG + Exonic
1061284427 9:129613998-129614020 CCCCAATGGCTGCCCCAGGATGG + Intronic
1061301658 9:129709202-129709224 CAGCAGGAGCTGCCCCTGGAAGG - Intronic
1061850211 9:133410512-133410534 AACCAGGGGCTGCCCCAGGCGGG + Intronic
1061872030 9:133526204-133526226 TACCAGTGGCTGCCTCTGCAGGG - Intronic
1061917682 9:133763678-133763700 CAGCAGATGCTGTCCCAGGAAGG - Exonic
1062028263 9:134350466-134350488 CCCCAGGGGCTGCCCGTGGGCGG + Intronic
1062232212 9:135487826-135487848 CACCTGGGGCTGCCTCTGCAGGG + Exonic
1062437421 9:136552725-136552747 GGCCAGAGGCTGCCCTGGGATGG + Intergenic
1062717337 9:138017836-138017858 CCGCAGGGGCTTCCCCTGGAGGG + Intronic
1186638113 X:11427674-11427696 GCCCAGGGGCTGCCCCAGGATGG - Intronic
1186808525 X:13163847-13163869 CTCCAGAGGCTACATCTGGAGGG + Intergenic
1187140596 X:16589592-16589614 TACCAAAGGCTGCCTCTGGAGGG + Exonic
1188520212 X:31030263-31030285 GGCCAGTGGCTGCCCCTGGGAGG + Intergenic
1189034116 X:37478845-37478867 AACCAGAGACTGTCCCCGGAGGG - Intronic
1191890283 X:65932402-65932424 AACCAGAGACTGTCCCTGGAGGG + Intergenic
1193462924 X:81811442-81811464 CACCAGAGGCTCCTCCTGCAAGG - Intergenic
1196441328 X:115722474-115722496 CACCAGCAGCATCCCCTGGAAGG + Intergenic
1196444857 X:115840463-115840485 CACCAGCAGCATCCCCTGGAAGG + Intergenic
1197244656 X:124155485-124155507 TATCAGAAGCTGTCCCTGGAGGG - Intronic
1198530501 X:137546849-137546871 ACCCAGAGGCTCCCCCCGGAAGG - Intergenic
1199718510 X:150525078-150525100 TACCAGAGGTTGTCCCTGGGTGG + Intergenic
1199791199 X:151156829-151156851 CTCCAGAGGCTGCCCATGCGTGG - Intergenic
1200066865 X:153508118-153508140 CACCAGAGGCTCCCCGTTGTTGG - Intronic
1200134977 X:153870411-153870433 GACCAATGGCTGCCCCTGCAAGG + Exonic
1202598680 Y:26570260-26570282 CATCAGAGGCTCCCCCTGCCTGG - Intergenic