ID: 1128645179

View in Genome Browser
Species Human (GRCh38)
Location 15:69373061-69373083
Sequence GCTGATGTGAAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 1, 1: 1, 2: 6, 3: 75, 4: 668}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128645179 Original CRISPR GCTGATGTGAAGATGGAGGA AGG (reversed) Intronic
900291303 1:1924691-1924713 GCTGATGAGAGGCTGGAAGAAGG - Intronic
900507760 1:3038254-3038276 ACTGATGTGCAGACGGAGGTAGG - Intergenic
900564647 1:3326249-3326271 GCTCATGTGAAGACAGAGGCGGG - Intronic
900628735 1:3622608-3622630 GGTCGTGTGAAGATGGAGGCAGG + Intergenic
901163361 1:7197578-7197600 GGAGATGTGAAGAGAGAGGAAGG + Intronic
901224729 1:7606701-7606723 GGGGATGGGAACATGGAGGATGG + Intronic
901471529 1:9460018-9460040 GCTGCTTTGAGGATGGAGGAAGG - Intergenic
902245445 1:15117721-15117743 TCTGATGGGAAGAGGGAGGTGGG - Exonic
904315595 1:29658365-29658387 GCTGAGCAGACGATGGAGGAGGG - Intergenic
904433787 1:30481063-30481085 GCTAATGTGATCATGGAGGCTGG + Intergenic
904629901 1:31833166-31833188 GCTGTTGTGAGGATGCAGCAAGG + Intergenic
905208732 1:36358652-36358674 GCAGGTGTGAAGGTGGAGGAGGG + Intronic
905235786 1:36546968-36546990 TCAGCTTTGAAGATGGAGGACGG + Intergenic
905259551 1:36707872-36707894 GGGGAAGAGAAGATGGAGGAAGG - Intergenic
905410177 1:37763291-37763313 TGTGATTTGAAGATGGAGGAGGG - Intronic
905766367 1:40604951-40604973 GCTCATGTGATTATGGAGGCTGG - Intergenic
906861923 1:49370040-49370062 GTTTATGTGATGATGGAGGCTGG - Intronic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
908000555 1:59674181-59674203 GCTGCTGTCAAGAGGAAGGATGG - Intronic
908022400 1:59911763-59911785 GCTGTCCTGAAGGTGGAGGAAGG + Exonic
908202526 1:61812323-61812345 GCTAATGTGGTGATAGAGGAAGG + Intronic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
908724366 1:67158774-67158796 TCTCATGTGAAATTGGAGGAGGG + Intronic
908816253 1:68038284-68038306 GCTGCTGTCAAGGTGGAGGTGGG - Intergenic
909551770 1:76905920-76905942 GCTGGTGTTAAGATGGAGAAAGG + Intronic
910259431 1:85281452-85281474 GGTCATGTGAAGATGGAGGCTGG - Intergenic
910418964 1:87035039-87035061 GATGCTGTGCAGCTGGAGGATGG + Intronic
910530833 1:88233594-88233616 ACAGATGAGAAAATGGAGGATGG - Intergenic
910604021 1:89063724-89063746 AATCATTTGAAGATGGAGGAAGG - Intronic
910611536 1:89148641-89148663 GCTGACTTGAAGATGGAGAGAGG + Intronic
910802433 1:91159574-91159596 CCAGCTTTGAAGATGGAGGAAGG + Intergenic
911740310 1:101379789-101379811 TTTGCTTTGAAGATGGAGGAAGG - Intergenic
912139906 1:106711708-106711730 GCTGGTGAGAATATGGAGAAAGG + Intergenic
912866734 1:113264344-113264366 GCTCATGAGAAGATGCAGGGAGG - Intergenic
912972528 1:114297434-114297456 GCTAATGTGATTATGGAGGCTGG - Intergenic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
913539556 1:119805804-119805826 GATGAAGTGAGGAAGGAGGAGGG - Intronic
914831422 1:151173615-151173637 CCTGATGGGGAGATGAAGGATGG + Exonic
914958680 1:152187434-152187456 GCTGATGTGAATATGGAAGCTGG + Intergenic
915393051 1:155562021-155562043 GCAGTGGTGAAGATGGGGGAGGG - Intronic
915409207 1:155687939-155687961 GCAGTGGTGAAGATGGGGGAGGG - Intronic
915816240 1:158968886-158968908 GCCTACTTGAAGATGGAGGATGG + Intronic
915824110 1:159057104-159057126 GGGGATGTGAGGATGGAAGAGGG - Intergenic
916291764 1:163174663-163174685 GCTGATGAGAAGAGGCAGGGAGG + Intronic
916733642 1:167588078-167588100 GCTGCTGAGAATATGGAGAAAGG + Intergenic
917514080 1:175692473-175692495 GCAGATGGAAAGATGGATGAAGG - Intronic
918295479 1:183152291-183152313 GCTGGTTTGAAGGAGGAGGAAGG + Intergenic
918489324 1:185063792-185063814 GCTGGCCTGAAGATGGAAGAAGG - Intronic
918510825 1:185312249-185312271 GATGATGTGAAAATGAGGGAGGG - Intronic
919429274 1:197472740-197472762 GCTGATGTGGCGCTGGTGGAAGG - Intronic
920084959 1:203408684-203408706 GCTGATGTGGGGAGGGAAGAAGG + Intergenic
920089939 1:203445267-203445289 GTTGGAGTGAAGACGGAGGATGG + Intergenic
920557193 1:206912861-206912883 GGCAATGTGAAAATGGAGGAGGG - Intronic
921312488 1:213858009-213858031 GCTGATGTAAGAAGGGAGGAAGG - Intergenic
922107514 1:222525416-222525438 GGTGATGTGTGGATGGTGGAGGG - Intronic
922214144 1:223507041-223507063 GCTGGGAAGAAGATGGAGGATGG + Intergenic
922224418 1:223632929-223632951 CCAGATGGGAAGAAGGAGGAAGG - Intronic
922504458 1:226118550-226118572 GGAGATGGGAAGAGGGAGGAAGG + Intergenic
922511953 1:226176104-226176126 GTGGCTCTGAAGATGGAGGAAGG + Intronic
922549724 1:226485141-226485163 TGTGCTGTGAAGATGCAGGAGGG + Intergenic
922725987 1:227923287-227923309 GCAAATGTGAAGATGAAGGCAGG + Intronic
922762128 1:228139849-228139871 CCTGCAGTGTAGATGGAGGACGG + Intergenic
922784442 1:228276114-228276136 GCTGAGGGGAGGAGGGAGGAGGG + Intronic
922784460 1:228276181-228276203 GCTGAGGGGAAGAGAGAGGAGGG + Intronic
922914929 1:229249455-229249477 GCTGAGGTGCAGATGCACGAAGG - Intergenic
923010272 1:230083021-230083043 GCAGTTGGGATGATGGAGGAGGG + Intronic
923141811 1:231166866-231166888 TCTGATGTGAAGATGGGATAGGG + Intronic
923286242 1:232498647-232498669 CTTGCTGTGAAGATGGAGGAAGG - Intronic
923548356 1:234941316-234941338 GGTAATGTGGAGATGGAGGTAGG - Intergenic
923644631 1:235805402-235805424 GCTGATGCGCAGATGGTGAATGG + Intronic
923973278 1:239229401-239229423 GCTTATGTGATTATGGAGGCTGG - Intergenic
924152841 1:241146085-241146107 GCAGATGGGAAGGTGAAGGAAGG + Intronic
924632345 1:245752755-245752777 GTGGATGTGAAGCTGGAGGAAGG - Intronic
924738589 1:246781084-246781106 GCGGCTTTGAAGATGGAGGGAGG + Intergenic
1063051337 10:2452719-2452741 GCTCATGTGACTATGGAGGCTGG + Intergenic
1064016307 10:11775070-11775092 GCTGATGGCAAGGTGGAGGAGGG - Intergenic
1064266471 10:13829547-13829569 GCTCCTGTGAAGATTGAGAAGGG - Intronic
1064682508 10:17825208-17825230 TCTGATGAGAACATGGGGGAGGG + Intronic
1065395437 10:25231726-25231748 ACAGAGGTGAATATGGAGGATGG + Intronic
1065532369 10:26685384-26685406 TCTGTGGGGAAGATGGAGGAGGG - Intergenic
1065837771 10:29674844-29674866 GCTGCCTTGAAGATGCAGGAAGG - Intronic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1066651922 10:37664504-37664526 GCTGGCTTGGAGATGGAGGAAGG - Intergenic
1067035697 10:42914815-42914837 GCTGGCTTGGAGATGGAGGAAGG - Intergenic
1067426507 10:46215359-46215381 ACTGATGTGGAGTGGGAGGAAGG - Intergenic
1067753464 10:48986601-48986623 GCTGGGGTGAGGATGGAGGCAGG + Intergenic
1068088972 10:52409163-52409185 TCTGCTGTGAACCTGGAGGAGGG - Intergenic
1069282354 10:66670483-66670505 GCTGCCTTTAAGATGGAGGAAGG - Intronic
1069603734 10:69726668-69726690 GCTACTGTGAGGATGAAGGAAGG - Intergenic
1069845614 10:71368825-71368847 TCAGATGAGAAAATGGAGGAGGG - Intergenic
1069945438 10:71982285-71982307 GCTGGTTTGCAGATGGAGGAAGG + Intronic
1070240381 10:74674292-74674314 GCTGGTGTGGAGAGGGAGCAGGG - Intronic
1070655448 10:78268004-78268026 GCTGGCTTGAAGATGGAGGAAGG + Intergenic
1070666978 10:78351897-78351919 GCCAATCTGAGGATGGAGGAGGG - Intergenic
1070718577 10:78740293-78740315 GCTGGTGAGGAGATGGGGGAGGG + Intergenic
1070846807 10:79529601-79529623 GCCTATGGGAAGATGGAGGGTGG - Intergenic
1070926992 10:80230666-80230688 GCCTATGGGAAGATGGAGGGTGG + Intergenic
1071336496 10:84604699-84604721 GCAGAAGTGAAGATGCAGAAGGG - Intergenic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072442745 10:95471414-95471436 GCTGAGGTTAGGGTGGAGGAGGG + Intronic
1072696757 10:97609608-97609630 GCTGGTGGGAAGGTGGAGGAAGG - Intronic
1073054616 10:100691168-100691190 GCTGAAGTGAAGTTTCAGGAAGG - Intergenic
1074847162 10:117408504-117408526 GGTCATGTGAAGATGGAGGCAGG + Intergenic
1074915194 10:117948556-117948578 AGTGATGTGAAGATGGAACAGGG + Intergenic
1075671683 10:124267563-124267585 GCTGAAGTGAAGCTTGAGGCTGG - Intergenic
1075904534 10:126069618-126069640 GCTGATGTGATGGTGGTGGTGGG + Intronic
1076432002 10:130410588-130410610 GTTGGTTTGAAGATGAAGGAAGG - Intergenic
1076563482 10:131382419-131382441 ACTGCTCTGAAGGTGGAGGATGG - Intergenic
1076684405 10:132190804-132190826 GCTGATGTGCACGTGGAAGATGG + Exonic
1077185267 11:1232941-1232963 GCTGAGTTGAAGATGGGGGCTGG + Intronic
1077425006 11:2471327-2471349 GCAGATGGGGAGAGGGAGGAGGG - Intronic
1077781654 11:5336557-5336579 GCAGATGTGATTATGGAGGAAGG - Intronic
1078693373 11:13604274-13604296 GAGGATTTGAAGATGGAGAAGGG - Intergenic
1079269578 11:18971784-18971806 CCTGAGGTGAAGGTGGAGGGCGG - Intergenic
1079797235 11:24820530-24820552 ACTCATGTGAAGATGGATTAAGG + Intronic
1079955073 11:26852230-26852252 GTTGCTGTGAAAATGGGGGAAGG + Intergenic
1080417627 11:32083621-32083643 GGTTATGTGTAGATGGAGAAGGG - Intronic
1080635682 11:34121271-34121293 GCTGCTGTCATGATGGAAGAAGG + Intronic
1080666510 11:34341015-34341037 GCTGATTTCAAGATGATGGAAGG - Intronic
1080686428 11:34519218-34519240 AAGGATGTGAAGATGGAGCATGG + Intergenic
1080770089 11:35332701-35332723 GCAGATGGGGAGAGGGAGGATGG - Intronic
1081129875 11:39365796-39365818 GTTGATGAGAAGATAGAGGAGGG + Intergenic
1081243789 11:40738347-40738369 GCTCATGTGATTATGGAGGCTGG - Intronic
1081501185 11:43668289-43668311 GCTGGTCTGAAGATGGAGGACGG - Intronic
1081528796 11:43944132-43944154 GCTGAAGTGAAGCCGCAGGAGGG + Intronic
1082933682 11:58634782-58634804 AGTTATGTGGAGATGGAGGAGGG - Intergenic
1083628273 11:64082934-64082956 GCTGCTGTGACGAGGAAGGAAGG - Intronic
1083629171 11:64086987-64087009 GCTGCTGTGTAGGTGGAGGCCGG - Intronic
1083664141 11:64265544-64265566 GCTGATGTGAACATGGGGGTCGG + Intronic
1083791162 11:64987023-64987045 GCTCATGTGATGATGGAGGTTGG - Intergenic
1084596449 11:70119588-70119610 GCTGATGGAAAGATGAATGATGG + Intronic
1084875476 11:72129177-72129199 AGTCATGTGAACATGGAGGAAGG - Intronic
1084923378 11:72491262-72491284 GCTCATGTGATTATGGAGGTGGG - Intergenic
1085251056 11:75144363-75144385 GCTGGTGTGAAACTGGAGGTAGG + Intronic
1085533466 11:77204811-77204833 GCTGATGTGTAGTTTGAGGATGG - Intronic
1086332634 11:85769373-85769395 TGTGTTTTGAAGATGGAGGAAGG + Intronic
1086994889 11:93345008-93345030 GCCTATCAGAAGATGGAGGATGG - Intronic
1087006531 11:93477389-93477411 GATGCTGTGAGGATGGAGCAAGG - Intergenic
1087115768 11:94522652-94522674 TCTGGTGTGGAGATAGAGGATGG - Intergenic
1087348454 11:97000861-97000883 GCTGATTTGAAGAGGAATGAGGG + Intergenic
1087990715 11:104743407-104743429 GATGAACTGGAGATGGAGGAAGG + Intergenic
1088444488 11:109910130-109910152 GCTGGTGAGAATATGGAGAAAGG - Intergenic
1088978515 11:114838897-114838919 GCACATGTGAAGATGGAAAAGGG + Intergenic
1089298937 11:117486383-117486405 GCGGATGTGAAAGTGGCGGATGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090600152 11:128361769-128361791 GCTGATGAGAAGTGGGCGGAAGG + Intergenic
1091049552 11:132355080-132355102 TGTGTTTTGAAGATGGAGGAAGG - Intergenic
1092595557 12:10000794-10000816 GCTGATGAGTAGATGTAGAAAGG - Intronic
1092978111 12:13765518-13765540 ACTGATGTCAAGATGGATGATGG + Intronic
1092995010 12:13941408-13941430 CCTGCTGTGAAGATGGACAAAGG + Intronic
1094316798 12:29144888-29144910 GGGGATATGAAGATGGAAGAAGG - Intergenic
1094658652 12:32444769-32444791 CCTGAGGTGAAGATAAAGGATGG + Intronic
1095228692 12:39707365-39707387 GCTGATGAGGATATGGAGAAAGG + Intronic
1095236487 12:39802322-39802344 ACGTATGTGAAGATGGTGGAAGG + Intronic
1095729171 12:45487451-45487473 GCTCATGTGATTATGGAGGATGG + Intergenic
1096436177 12:51592108-51592130 GCTGATGGTAAGGTGGGGGAGGG - Intronic
1096756940 12:53807549-53807571 GCTGAAGAGAAGAATGAGGAAGG - Intergenic
1096814381 12:54192574-54192596 CCTGAAGTAAAGATGTAGGAAGG + Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1097622408 12:61956368-61956390 GATTTTGAGAAGATGGAGGAAGG - Intronic
1097959699 12:65520495-65520517 GCTGTTGGGAAGCTGGTGGAAGG - Intergenic
1098223259 12:68292717-68292739 CCTGGGGTGAAGATGGGGGAGGG + Intronic
1098528164 12:71510789-71510811 ACTGATGAGAAGGTGGAGGAGGG + Intronic
1099104796 12:78484774-78484796 GCTCATGTGAATAAGGAGGGGGG - Intergenic
1099491056 12:83288548-83288570 GCTGAAGAGAAGAAAGAGGAGGG - Intergenic
1099494062 12:83322882-83322904 TCTGATGAGTAGATGGAGGAAGG + Intergenic
1099764275 12:86961677-86961699 GCACAGCTGAAGATGGAGGAGGG + Intergenic
1100523638 12:95400030-95400052 GCTGTTTTGAAGGTGGAGGAAGG + Intergenic
1101081478 12:101189802-101189824 TGTGATGTGAAGGTGGAGGATGG - Intronic
1101407708 12:104443271-104443293 GTGGCTTTGAAGATGGAGGATGG + Intergenic
1101560909 12:105857200-105857222 GATGATGAGTAGATGGATGATGG + Intergenic
1101839891 12:108320583-108320605 GCTGAGGGGAAGATGGAAGAAGG - Intronic
1102543898 12:113641205-113641227 GCTGGGGTGGAGGTGGAGGAAGG - Intergenic
1103041686 12:117701045-117701067 CCTATTGTGCAGATGGAGGATGG - Intronic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1103235021 12:119364919-119364941 AATGATGTGAAGATGGAGACAGG + Intronic
1103454648 12:121055408-121055430 CCTGATTTCAGGATGGAGGAGGG - Intergenic
1103741508 12:123094646-123094668 GCATCTGTGCAGATGGAGGACGG - Intronic
1104369869 12:128215113-128215135 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1104369994 12:128215971-128215993 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1104400680 12:128473527-128473549 GCTGGAGTGAAGATGGATGGTGG - Intronic
1104402423 12:128487246-128487268 GCTGATTAGAACAAGGAGGATGG - Intronic
1104768426 12:131345508-131345530 GCTGCTGTGAGGATGAATGAGGG - Intergenic
1104811620 12:131623080-131623102 GCTGCTGTGAGGATGAATGAGGG + Intergenic
1105047698 12:133019572-133019594 GCTGGTGAGGATATGGAGGAAGG + Exonic
1105402876 13:20111055-20111077 GCTCATGTGATTATGGAGGCTGG - Intergenic
1105534091 13:21247959-21247981 GATGATGTGAATATAGAGAAAGG + Intergenic
1106879155 13:34110266-34110288 GCTGCTGTGGGGATGGAGGTGGG + Intergenic
1107368339 13:39711589-39711611 ACTGATGAGAAGGAGGAGGAAGG - Intronic
1107747293 13:43524098-43524120 GATGATGTGAAGAAGGTGGTTGG - Intronic
1108313624 13:49218476-49218498 ACTGAAGTGGAGGTGGAGGAAGG + Intergenic
1108490790 13:50979126-50979148 TCTGATTTGAAGATGGAGGTGGG + Intergenic
1108715263 13:53072380-53072402 CCTGGTGTGGAGATTGAGGAAGG + Intergenic
1108764022 13:53604644-53604666 GCTCATGTGATTATGGAGGCTGG - Intergenic
1109929900 13:69202027-69202049 GGTGATGTGAGGAAGCAGGAAGG - Intergenic
1110574449 13:77039772-77039794 TCGGCTTTGAAGATGGAGGAAGG - Intergenic
1110611356 13:77491584-77491606 GCAGATGTGGAGAAGGTGGAGGG + Intergenic
1110658227 13:78026041-78026063 GCTGGCTTGAAGATGGAGGGAGG + Intergenic
1110865716 13:80393252-80393274 TATGTTTTGAAGATGGAGGAAGG + Intergenic
1111598951 13:90447175-90447197 GCTGGAGTGGAGAAGGAGGATGG - Intergenic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1112279065 13:98046813-98046835 GCTGATGTGAGGATACAGGGAGG - Intergenic
1112407188 13:99131485-99131507 AGTGCTTTGAAGATGGAGGAAGG + Intergenic
1112463705 13:99624955-99624977 TCTGAGGTGAAGGTGGGGGAAGG - Intronic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113283333 13:108815477-108815499 GCTGCTTTGAAGATGGTGGAAGG + Intronic
1113408744 13:110065290-110065312 GCTGCTTTGAAGATGGAGGGAGG - Intergenic
1113541305 13:111111958-111111980 GCTCATGTGACTATGGAGGTGGG + Intergenic
1113767153 13:112888686-112888708 GCAGCGGTGAGGATGGAGGAAGG + Intergenic
1113948675 13:114059245-114059267 TGTGCTGTGAAGATGCAGGAGGG - Intronic
1114312154 14:21477267-21477289 GGTTGTGTGAAGATGGAGGTAGG + Exonic
1114811513 14:25905813-25905835 GAAGATGTGAAGAGGGAGAATGG - Intergenic
1116371838 14:44144866-44144888 TCTCATGTGAAATTGGAGGAGGG + Intergenic
1116610613 14:47066715-47066737 GATAATCTGAAGATGGAAGAAGG + Intronic
1117465185 14:55986226-55986248 GCTGAAGTGTATGTGGAGGAGGG - Intergenic
1118375031 14:65169426-65169448 GCTGAAATGAAGAAGGAGGCTGG + Intergenic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119877050 14:78069837-78069859 GGTCATGTGAAGATGGAGGTAGG + Intergenic
1120073232 14:80126361-80126383 GGTGATGTCAATATGAAGGAGGG - Intergenic
1120116482 14:80624078-80624100 GGTACTGTGAAGATTGAGGAAGG - Intronic
1120184698 14:81382556-81382578 GGGGATGTGATGAGGGAGGAGGG + Intronic
1121578068 14:95004624-95004646 GGCGATGTGAAGACGGAGGTAGG + Intergenic
1121609856 14:95270439-95270461 GCTGAGGGGAAGGTGGAGAATGG - Intronic
1121932507 14:97985497-97985519 GCTGCCTGGAAGATGGAGGAAGG - Intergenic
1122409813 14:101520128-101520150 ACTGAGGTCAAGATGGAGCAGGG - Intergenic
1122601276 14:102923120-102923142 CCTGGTGTGAAGGCGGAGGAGGG - Intronic
1123499588 15:20867422-20867444 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1123556840 15:21441152-21441174 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1123593063 15:21878388-21878410 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1123784520 15:23656246-23656268 GCTCATGTGATTATGGAGGCTGG + Intergenic
1124432144 15:29617113-29617135 GCTCATGTGATTATGGAGGCTGG + Intergenic
1125636670 15:41194370-41194392 GGTGATGTGATGATGGAAGCAGG + Intronic
1126181968 15:45794089-45794111 GCTGATGTGAGGAATGAGAAAGG + Intergenic
1127629483 15:60813577-60813599 GCTGATGGGAAGATGGGCAAAGG - Intronic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1128780861 15:70357699-70357721 GCTGATGTGCAGATGGGTGATGG + Intergenic
1129101153 15:73265318-73265340 GCCGATCTGAAGCTGGAGGCAGG + Intronic
1129157184 15:73725699-73725721 GCTGGCTTGAAGACGGAGGAAGG + Intergenic
1129698644 15:77754934-77754956 GCTGTTGTGAAGCTTGAGGCAGG + Intronic
1130000019 15:80038208-80038230 GCTCATGTGATTATGGAGGCTGG + Intergenic
1130078497 15:80710474-80710496 GCTGATATGTCGAGGGAGGAAGG + Intronic
1130697501 15:86145277-86145299 GTTGAAGGGAAGATGGAAGAAGG + Intronic
1130815378 15:87426579-87426601 GCTGATATGCAGATGGCAGAAGG - Intergenic
1130962807 15:88674792-88674814 GGCTATGTGAAGATGGAGGCAGG - Intergenic
1131066376 15:89437204-89437226 GAGGATGTGAAGCAGGAGGAAGG - Intergenic
1131940387 15:97558417-97558439 CTAGATTTGAAGATGGAGGAAGG - Intergenic
1202965183 15_KI270727v1_random:168341-168363 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1132989864 16:2787048-2787070 GCAGGGGTGACGATGGAGGACGG - Intronic
1133120104 16:3601054-3601076 TGTGCTGTGAAGATGGAGGTTGG - Exonic
1133318477 16:4898545-4898567 GGCCATGTGAAGACGGAGGAAGG + Intronic
1133364112 16:5197439-5197461 GCTGGCTTGAAGGTGGAGGAAGG + Intergenic
1133701342 16:8311988-8312010 GGTGATGTGAAGATGCAGGAGGG + Intergenic
1133740023 16:8644378-8644400 GCTGTCGTGCAGATGTAGGAAGG + Intronic
1133899952 16:9964646-9964668 GCTGGCTTGAAGATGAAGGAAGG - Intronic
1133904068 16:10004641-10004663 CTTGCTTTGAAGATGGAGGAAGG - Intronic
1134104501 16:11476189-11476211 GCAGATGCGAGGAGGGAGGAGGG + Intronic
1134362781 16:13547392-13547414 GCTCATGAGATTATGGAGGAAGG + Intergenic
1134764419 16:16744257-16744279 GTTGCTTTGAAGATGGAGGAAGG + Intergenic
1134780097 16:16887684-16887706 GCTGAATAGGAGATGGAGGAAGG + Intergenic
1134885444 16:17786844-17786866 GCTGATCCGAAGATGGGGGGCGG - Intergenic
1134981639 16:18614957-18614979 GTTGCTTTGAAGATGGAGGAAGG - Intergenic
1135247414 16:20868992-20869014 GCTGATGTGCAGAGGAGGGAGGG - Intronic
1135390111 16:22085383-22085405 GATGATGTGAAGATAGGGTAGGG - Intronic
1135509236 16:23068258-23068280 GCTGCTGGGAAGCTGGAGGCTGG + Exonic
1136381857 16:29899629-29899651 GAGGAAGTGCAGATGGAGGAGGG + Intergenic
1136571275 16:31098455-31098477 TCTGGTTTGAAGATGGAGGAAGG + Intergenic
1137525988 16:49236756-49236778 CCGGCTATGAAGATGGAGGAGGG + Intergenic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137579842 16:49627162-49627184 ATTGATGGGTAGATGGAGGATGG - Intronic
1137860120 16:51838325-51838347 GCTGCTTTGAAGACAGAGGAAGG + Intergenic
1138952852 16:61934417-61934439 GCTTATGTAAAGATTGTGGAGGG + Intronic
1139504480 16:67392199-67392221 GTGGGTGTGAAGATGGAGGATGG - Intronic
1139790848 16:69433529-69433551 GCTGTGGTGAAGGAGGAGGAGGG - Intronic
1140124818 16:72110411-72110433 GCTGATGGGAGGATGGATGAGGG + Intronic
1140904411 16:79398144-79398166 TTTGATTTGAAGATGGAGCAAGG - Intergenic
1140944078 16:79751218-79751240 GCTGGTTTGAAGATGGAGGAAGG + Intergenic
1141149206 16:81552539-81552561 GTGGCTCTGAAGATGGAGGAAGG - Intronic
1141250948 16:82358602-82358624 GCTACTTTGAAGATGGAGGAAGG + Intergenic
1141268661 16:82519727-82519749 TGTGCTCTGAAGATGGAGGAAGG + Intergenic
1141487412 16:84349912-84349934 AGAGATTTGAAGATGGAGGAAGG + Intergenic
1141788199 16:86215771-86215793 TCGGCTCTGAAGATGGAGGAGGG - Intergenic
1142147231 16:88497692-88497714 GCTGCTGTGAGGCGGGAGGAGGG + Intronic
1142470842 17:162486-162508 CCCGCTGTGAAGGTGGAGGAAGG + Intronic
1142768354 17:2078821-2078843 GCTGAAGGGAAGCTGAAGGAAGG + Intronic
1142889218 17:2932185-2932207 GCTGATGTGGTCATGGGGGATGG + Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1144591577 17:16528599-16528621 ACTGATGTGAAGATGCCAGATGG + Intergenic
1146199611 17:30845270-30845292 GCTTAAGTGGAGATGGAAGATGG + Intronic
1146463652 17:33067790-33067812 GCTAATGAGAGGATGGAGGTGGG + Intronic
1146519335 17:33514358-33514380 GAGGATGGGGAGATGGAGGAAGG - Intronic
1148404739 17:47400918-47400940 ACTGATGTGAAGCTAGTGGAAGG + Intronic
1149035933 17:52134697-52134719 GCAGATGTGCAGTTGTAGGAGGG - Intronic
1149375004 17:56034935-56034957 GTTGTTTTGAAGATGGAGAAAGG - Intergenic
1151025488 17:70671749-70671771 GTGGCTTTGAAGATGGAGGAAGG + Intergenic
1151917568 17:77129670-77129692 GCAGAGCTGAAGGTGGAGGAGGG + Intronic
1152264474 17:79286402-79286424 GGTGATTTGGTGATGGAGGAGGG - Intronic
1152473645 17:80503833-80503855 GTGGATGTGTGGATGGAGGATGG + Intergenic
1153160533 18:2199909-2199931 GCTGGTGGGAAGAGGTAGGAGGG + Intergenic
1153265393 18:3263732-3263754 GCTAATGTGTAGAATGAGGAAGG - Intronic
1153276910 18:3376553-3376575 CTAGCTGTGAAGATGGAGGAAGG - Intergenic
1153379776 18:4425380-4425402 GTTGATGTGAGGGTGAAGGAAGG + Intronic
1153718560 18:7877363-7877385 GCTGATTTAAAGATGGATGTTGG + Intronic
1154457645 18:14544297-14544319 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1155028653 18:21964912-21964934 GCTCATGTGATGATGGAAGCTGG - Intergenic
1155370461 18:25094795-25094817 GCAAGTGTGAAGATGGGGGAAGG - Intronic
1156093076 18:33494743-33494765 AGTGCTTTGAAGATGGAGGAAGG - Intergenic
1156698513 18:39796183-39796205 GGGGATGTGAGGATGGAAGAGGG - Intergenic
1157245267 18:46048223-46048245 GGTGGCTTGAAGATGGAGGAAGG + Intronic
1157288669 18:46394495-46394517 GCTGGGGGGAAGGTGGAGGATGG - Intronic
1157552163 18:48589366-48589388 GTACATGTGAAGATGGAGGCAGG - Intronic
1157669644 18:49517526-49517548 GCTCACGTGATGATGGAGGCTGG + Intergenic
1158157055 18:54437888-54437910 GAGGCTGTGAAGCTGGAGGATGG - Intergenic
1158492007 18:57918523-57918545 GCCGCTTTGAATATGGAGGAAGG - Intergenic
1159046800 18:63376424-63376446 GCTGCTTTGAAAGTGGAGGAGGG + Intergenic
1159102619 18:63972167-63972189 GCGGATGTGATGAGGGAGGAGGG - Intronic
1159173477 18:64803623-64803645 GCCTATGTGAAGGTGGAGGGTGG - Intergenic
1159307599 18:66664493-66664515 TCTGATGTGCAGTTGGAGTAGGG - Intergenic
1159558415 18:69968734-69968756 GGAGATGTGAAGAGGGAAGAAGG - Intergenic
1159869027 18:73739903-73739925 GCTCATGGAAGGATGGAGGATGG - Intergenic
1160087075 18:75786480-75786502 GGGGATGTGACCATGGAGGAAGG - Intergenic
1160458315 18:79018674-79018696 GGCCATGTGAAGATGGAGGCGGG - Intergenic
1161326908 19:3668437-3668459 GTGGCTGTGAAGAGGGAGGAAGG + Intronic
1161503190 19:4628979-4629001 GCTGGCTTGGAGATGGAGGAAGG - Intergenic
1161711148 19:5848853-5848875 ACTGTTGGGCAGATGGAGGAGGG - Intronic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1161999880 19:7737205-7737227 GATGACGTGAAGAGGTAGGAAGG + Intergenic
1162825616 19:13249745-13249767 GCTGAGGTGGAGGGGGAGGATGG + Intronic
1163290508 19:16376568-16376590 TCTGATGTGAGGAGGCAGGATGG - Intronic
1163706105 19:18814296-18814318 GCTGATGTGGAACTCGAGGAGGG + Intergenic
1164404544 19:27932349-27932371 GATGAAGAGAAGAAGGAGGAAGG - Intergenic
1164593458 19:29518842-29518864 GGTGATGTGAGGATGTAGCATGG - Intergenic
1164712624 19:30368260-30368282 GCTAAGGAGAAGCTGGAGGATGG - Intronic
1164767597 19:30783764-30783786 GCTGAAGTTCAGAGGGAGGAAGG + Intergenic
1164861339 19:31564562-31564584 GCTGATGGGAAGTTGAATGAAGG - Intergenic
1165424009 19:35735833-35735855 GTGGATGTGAAGAAGGGGGATGG - Intronic
1166053520 19:40275061-40275083 GCAGATGTGAAAACCGAGGATGG + Intronic
1166195731 19:41204507-41204529 TCTGCAGTGAAGGTGGAGGAGGG - Intronic
1166769402 19:45271817-45271839 TCTCATGGGAAGATGGGGGATGG + Intronic
1166992998 19:46704476-46704498 GCTGGTGAGGAGATGGGGGATGG - Exonic
1167130927 19:47585237-47585259 ACTGAGCTGAAGATGGAAGACGG - Intergenic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1167601220 19:50455969-50455991 GTGGATGTTAAGATGGATGAAGG - Intronic
1167689804 19:50978354-50978376 GCAGATGTGAGCAAGGAGGATGG + Intronic
925090811 2:1154476-1154498 GCTGATGAGAAGTTGGGTGAAGG + Intronic
925194021 2:1908712-1908734 GCTGATGGGGAGAGGGAGGGTGG + Intronic
925247347 2:2395752-2395774 GGTGATGTGTAAATGGAGGTAGG + Intergenic
926176292 2:10595225-10595247 GAAGAGGTGAAAATGGAGGAAGG + Intronic
926384672 2:12324507-12324529 GCTCATGTGATTATGGAGGCTGG + Intergenic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
927238285 2:20898226-20898248 TCTGATGTGAAGATGCAGCAGGG + Intergenic
927523692 2:23718833-23718855 TGTGATCTGAAGATGGAAGAAGG - Intergenic
928362800 2:30679356-30679378 TCTGATGTGAAAGTGGTGGAGGG - Intergenic
929046648 2:37797119-37797141 GCTGAAGTGTAGAGGGAGGGAGG - Intergenic
929098011 2:38282195-38282217 GGAGATGTGAAGATAGAGTAAGG + Intergenic
929099865 2:38301515-38301537 GCTGCTGAGAGGATGGGGGAGGG - Intronic
929548446 2:42873490-42873512 GCTCATGTGATTGTGGAGGATGG + Intergenic
930035609 2:47083520-47083542 GGTGATGGGAGGAGGGAGGACGG - Intronic
930445873 2:51471496-51471518 GCTGATGTAGAGAGGGACGATGG + Intergenic
930772376 2:55141165-55141187 GGTTATGTGAAGATGGAGTCAGG - Intergenic
931161012 2:59690571-59690593 GATGATGTTAATAAGGAGGATGG + Intergenic
932293816 2:70607897-70607919 GTTGTTGTGAAGATTAAGGAAGG - Intronic
932538651 2:72627107-72627129 GCTGTTATGAAGATAGAGGATGG + Intronic
934843984 2:97649969-97649991 GTGGCTTTGAAGATGGAGGAAGG + Intergenic
934916616 2:98305461-98305483 AGTGATGTGAAGATTGGGGACGG + Intronic
934935908 2:98465275-98465297 GCTGGTGTGAAGATGAGGAAGGG - Intronic
936407360 2:112217998-112218020 GCTGCTGTGGAGGTGGAGGCAGG - Intronic
937198285 2:120179869-120179891 ACTGACAGGAAGATGGAGGATGG + Intergenic
937225912 2:120368567-120368589 GGTGAGGGGAAGAGGGAGGAGGG + Intergenic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937453556 2:122022538-122022560 TCTGAAGGGAAGATGGAGTAAGG + Intergenic
937600088 2:123721177-123721199 GTGGCTTTGAAGATGGAGGAAGG - Intergenic
938127557 2:128685517-128685539 GAGGATGTGAAGCAGGAGGAAGG + Intergenic
938643757 2:133310318-133310340 GCTGATGCTAAGATGGCGGTGGG - Intronic
938805005 2:134797886-134797908 GCTGATCTGGAGTTGGAGGCTGG + Intergenic
938908899 2:135867044-135867066 GCTTAGGAGAAGATGGAGCATGG - Intronic
939677040 2:145085339-145085361 GGTGAAGTGAAGATGGAGATAGG + Intergenic
939785996 2:146513913-146513935 TCAGATGTGAACATGGAGGTGGG + Intergenic
940019882 2:149145645-149145667 GCTGATGTTAAAAGGGAGAAGGG - Intronic
940098585 2:150007160-150007182 GCTGTTCTGAAAATAGAGGAGGG + Intergenic
943645577 2:190405949-190405971 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
944903416 2:204238808-204238830 TGTGGTTTGAAGATGGAGGAGGG + Intergenic
945077677 2:206056552-206056574 GCTGCTGTGAAGGTGCAGGAGGG + Exonic
945276835 2:207996326-207996348 GGTGATGTGAAGGTGGAGAAAGG + Intronic
945386330 2:209206145-209206167 ACTGAGGTGAGGATGGATGAAGG - Intergenic
945547879 2:211180488-211180510 GTGGAGGTGAAGATGGATGAGGG + Intergenic
945914902 2:215693309-215693331 GAGGATGTGAAGTTGGGGGAAGG + Intergenic
946231150 2:218292045-218292067 GCTGGTGAGAAGAGGGAAGAGGG - Intronic
946628429 2:221640397-221640419 GCTGATGAGGATATGGAGAAAGG - Intergenic
946775594 2:223136938-223136960 GCTCATGTGATTATGGAGGCTGG - Intronic
948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG + Exonic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948273519 2:236691569-236691591 CCGGCTTTGAAGATGGAGGAAGG + Intergenic
948322017 2:237077606-237077628 CCTGATGTTAAGATGGAGTAAGG - Intergenic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
1169266143 20:4168287-4168309 GCAGATGTGCGGTTGGAGGAGGG + Intronic
1169757263 20:9056059-9056081 GCTGCATTGAAGACGGAGGAAGG + Intergenic
1169787390 20:9374526-9374548 GGTGAGGTGAAGAGGGAAGACGG + Intronic
1170421646 20:16199487-16199509 GCTGGTTTGAAGATGTGGGAAGG - Intergenic
1170595169 20:17799887-17799909 GCTAGTGTGAAGGTGGAGGAAGG + Intergenic
1170866460 20:20162131-20162153 CCAGCTCTGAAGATGGAGGAAGG - Intronic
1172946118 20:38690783-38690805 GATGATTGGCAGATGGAGGAAGG - Intergenic
1173149853 20:40557656-40557678 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173437624 20:43047076-43047098 TCTGAGGGGAAGAGGGAGGAGGG - Intronic
1173554055 20:43953052-43953074 ACGGCTATGAAGATGGAGGAAGG + Intronic
1173573664 20:44095981-44096003 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1174525210 20:51164962-51164984 TCTGATGTGAAGTTTCAGGAAGG - Intergenic
1174710237 20:52696838-52696860 GCTTACTTGAGGATGGAGGATGG + Intergenic
1175669868 20:60892902-60892924 GATGATGTGAGGATGGGGGAAGG + Intergenic
1175989842 20:62782965-62782987 TTTGCTCTGAAGATGGAGGATGG + Intergenic
1176193337 20:63824699-63824721 AGTGATGGGAAGATGGGGGAGGG - Intronic
1176193352 20:63824751-63824773 AGTGATGGGAAGATGGGGGAGGG - Intronic
1176193367 20:63824803-63824825 AGTGATGGGAAGATGGGGGAGGG - Intronic
1176193382 20:63824855-63824877 AGTGATGGGAAGATGGGGGAGGG - Intronic
1176193397 20:63824907-63824929 AGTGATGGGAAGATGGGGGAGGG - Intronic
1176193412 20:63824959-63824981 AGTGATGGGAAGATGGGGGAGGG - Intronic
1176193427 20:63825011-63825033 AGTGATGGGAAGATGGGGGAGGG - Intronic
1176193442 20:63825063-63825085 AGTGATGGGAAGATGGGGGAGGG - Intronic
1176218189 20:63957983-63958005 CCTGATGAGAGGATGGAGGCTGG - Exonic
1176517962 21:7800449-7800471 GAAGATGTGAAGATGGAGGCAGG + Intergenic
1176816512 21:13609041-13609063 ACTGATGGGGAGATGCAGGAAGG - Intergenic
1176910753 21:14561833-14561855 GGCCATGTGAAGATGGAGGCAGG + Intronic
1177484798 21:21743473-21743495 GCTGACTGGAAGATGCAGGAAGG + Intergenic
1177890499 21:26798652-26798674 GCTGCTTTGAAAATGGAGGAAGG - Intergenic
1178354252 21:31897446-31897468 GATGATGTGAAGACAGAGGGAGG - Intronic
1178651990 21:34430462-34430484 GAAGATGTGAAGATGGAGGCAGG + Intergenic
1178683735 21:34695222-34695244 GCTGGAGTAAAGACGGAGGATGG - Intronic
1178925855 21:36774364-36774386 GTTGATATGAACATGGAGTAAGG + Intronic
1179169469 21:38961859-38961881 GGTGATGTGATGATGGAAGGAGG - Intergenic
1180889734 22:19278152-19278174 GCTGATGTGTAGATAGATGTCGG - Intronic
1181495178 22:23283621-23283643 TCTGCTGTGAAGATGGGTGATGG - Intronic
1181532661 22:23525771-23525793 GATGATGAGAAGACGGAGGGCGG - Intergenic
1181536976 22:23551396-23551418 GATGAAGTGTGGATGGAGGATGG - Intergenic
1182552212 22:31106578-31106600 GCTGAGGGTAGGATGGAGGAGGG - Intronic
1182893629 22:33840590-33840612 GTTGCTGTAAAGATGAAGGAGGG - Intronic
1183260129 22:36789432-36789454 GCAGAGGTGAAGACGGAGGCTGG - Intergenic
1183597626 22:38822108-38822130 GCTGGTGGAAAGAGGGAGGAGGG + Exonic
1183779916 22:39992840-39992862 GCTTATGGGAATATGAAGGAAGG - Intergenic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1184538241 22:45102070-45102092 GCAGATGTGATGGAGGAGGAAGG - Intergenic
1184679560 22:46062957-46062979 GCTGTTGTGAGGATGGAGCTGGG + Intronic
1184808947 22:46815831-46815853 GCTGGTGGGAGGATGGAAGATGG + Intronic
1185095415 22:48803640-48803662 GCAGCTGGGAAGATGGTGGAGGG + Intronic
949514132 3:4792078-4792100 GCTGCTTTGAAGGTGGAGGGAGG - Intronic
950342852 3:12262945-12262967 GCAGATGTGGAGATGCAGGGAGG + Intergenic
950689356 3:14643356-14643378 GCAGATGAGGAGATGGAGGCCGG - Intergenic
951301306 3:21000459-21000481 GTTGTTGTGGAGATGGTGGATGG + Intergenic
951632606 3:24737901-24737923 ATTGATGTGAAGCTGTAGGATGG + Intergenic
952282722 3:31938996-31939018 GTTGATCTGAAGCAGGAGGAAGG - Intronic
952721711 3:36540585-36540607 ATGGATGTGAAGATGGAGAAAGG + Intronic
953418273 3:42735288-42735310 GGTGAAGAGAAGATGCAGGAGGG + Intronic
953731303 3:45450826-45450848 GCTGGTGAGAATATGGAGAAAGG - Intronic
953900935 3:46843557-46843579 GCGGCTTTGAAGATGGAAGAAGG + Intergenic
954411357 3:50372632-50372654 GCTCATGTGAAGCTGTGGGAAGG - Intronic
954480693 3:50797245-50797267 GGTGGTGTGAGGATGGAGGTGGG + Intronic
954575872 3:51675941-51675963 GCTGAAGGGCAGGTGGAGGAGGG + Intronic
954920223 3:54184375-54184397 GGTGATGGGAGGATGGGGGAGGG - Intronic
955116341 3:56008330-56008352 CCTGATGTGAAGAATGAGAATGG - Intronic
955959789 3:64328414-64328436 GCTCATGTGATTATGGAGGCTGG - Intronic
956775518 3:72562230-72562252 TGTGCTGTGAAGATGGAGGAAGG + Intergenic
956919476 3:73911913-73911935 TCTGATGTGAGGTTGGAGTAGGG + Intergenic
957131563 3:76229626-76229648 CCTGATGTGAATATAGAGAAAGG - Intronic
957284242 3:78197098-78197120 GCTCATGTGATTATGGAAGATGG + Intergenic
957541910 3:81582328-81582350 GCTGCTTTGAGGATAGAGGAAGG + Intronic
957884307 3:86264828-86264850 CCTGATGTAAACATAGAGGAAGG + Intergenic
957923881 3:86782560-86782582 GAAGCAGTGAAGATGGAGGAAGG - Intergenic
959016833 3:101144211-101144233 GCTAGCTTGAAGATGGAGGAAGG + Intergenic
959960570 3:112293709-112293731 GCTGATCTTGAGCTGGAGGAAGG - Intronic
960100084 3:113732585-113732607 GACAATGTGAAGATGGAGGTAGG - Intronic
960362670 3:116733675-116733697 GGTGATGTGAAGATGTTAGAAGG - Intronic
960372097 3:116853087-116853109 GCTCATGTGATTATGGAGGCTGG - Intronic
960444509 3:117731210-117731232 GCAAATGTGGAGGTGGAGGAGGG + Intergenic
961080923 3:124027145-124027167 GTTGGTTTGGAGATGGAGGAAGG + Intergenic
962456000 3:135566327-135566349 GCTTTGGTGGAGATGGAGGAAGG + Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963778812 3:149466255-149466277 GCTGAAAGGAAGATGGATGAAGG + Intergenic
964565942 3:158052599-158052621 GCTGATGTGATTATGGAGGCTGG - Intergenic
965159457 3:165113285-165113307 GCTCATGTGATGATGGAAGGTGG + Intergenic
966816840 3:183896511-183896533 ACTGATGTGAGCCTGGAGGAAGG - Intergenic
967002627 3:185351187-185351209 GCCTATTTGAAGGTGGAGGATGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967155271 3:186686000-186686022 GCTTATTTCAGGATGGAGGAGGG - Intergenic
967317223 3:188160861-188160883 GCTAATGGGAACATGGAGAAAGG + Intronic
969291736 4:6244499-6244521 GGTGGGGTGAAGATGGAGTAAGG + Intergenic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969973024 4:11067423-11067445 CATCATGTGAAGATGAAGGAGGG - Intergenic
970798490 4:19944335-19944357 GGAAATGTGGAGATGGAGGAAGG - Intergenic
971216795 4:24669708-24669730 GCAGAAGAGAAGAAGGAGGAAGG - Intergenic
971307519 4:25496603-25496625 CCTGAGGTGAAGATGGAGAATGG + Intergenic
971339361 4:25753634-25753656 GCTGATGGGATGATGGGGCAGGG - Intronic
971514266 4:27467158-27467180 GCTGTTGCTAAGATGGAAGATGG + Intergenic
973077230 4:45944487-45944509 ACTGATGAGGAGATGGATGAGGG - Intergenic
973184665 4:47311515-47311537 TGTGCTTTGAAGATGGAGGAAGG + Intronic
974083999 4:57240148-57240170 GCTGAGGTAAAGATGGGGGTTGG - Intergenic
974267934 4:59609773-59609795 AGTGATGTGAAAATGGAGTAGGG + Intergenic
975570705 4:75815074-75815096 ACTGTGGTGAAGATGGAGAATGG - Intergenic
975812938 4:78188431-78188453 GCTCATCTGATGATGGAGGCTGG + Intronic
976436974 4:85029567-85029589 GCTCATGTGATTATGGAGGCTGG + Intergenic
977464601 4:97368029-97368051 CTTGCTTTGAAGATGGAGGAAGG - Intronic
977569880 4:98617950-98617972 TGTGAAGTGAAGTTGGAGGAGGG - Intronic
979120003 4:116886346-116886368 GGTGATGTGGTGATGGTGGATGG - Intergenic
979606234 4:122641892-122641914 GATGATATGAGGATGGAGTAAGG + Intergenic
979771680 4:124532987-124533009 GCTGTTGTGAGGATGGAAGCTGG - Intergenic
980092470 4:128456654-128456676 GCAGATGTGAGGATGAAGCAAGG + Intergenic
980736419 4:136895376-136895398 GCTCATGTGATTATGGAGGCTGG - Intergenic
981310040 4:143288855-143288877 GCTGATGTGAATAAAAAGGAGGG - Intergenic
981344079 4:143655012-143655034 CCTGGTGTGGAAATGGAGGATGG - Intronic
981564893 4:146089900-146089922 GCTGATTTAGAGAAGGAGGAAGG + Intergenic
982459648 4:155652768-155652790 GGTCATGTGAAGATGGAGACAGG + Intergenic
983417934 4:167482129-167482151 ACTGATGTAAAGAAGTAGGATGG + Intergenic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
983942934 4:173555224-173555246 GCTGATGAGAATGTGGAGAAAGG + Intergenic
984093183 4:175401420-175401442 GCTAATGTGATTATGAAGGATGG - Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
984790999 4:183614973-183614995 GATGCTTTGAAGATTGAGGAAGG + Intergenic
984871136 4:184326091-184326113 GCTCATGTGATTATGGAGGCTGG - Intergenic
985617965 5:935915-935937 TCTCATGTCAAGTTGGAGGAGGG - Intergenic
985818163 5:2141937-2141959 GCGGATGAGCAGATGGAGGCAGG + Intergenic
985977691 5:3434026-3434048 GCTGACTTGGAGATGGAGAAAGG - Intergenic
986059116 5:4171325-4171347 GCTGAAGGGAAGACAGAGGATGG + Intergenic
986520005 5:8605168-8605190 GCTTATGTGATTATGGAGGCTGG - Intergenic
986785734 5:11112360-11112382 CCGGATCTGAAGATGGTGGAAGG + Intronic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
986912080 5:12570374-12570396 GTGAATGTGAAGATGGAGGCAGG + Intergenic
987211973 5:15692834-15692856 GAAGATGTGAAGAATGAGGAAGG + Intronic
988529734 5:32017024-32017046 ACAGATGTGCAGATGGGGGATGG + Intronic
988615875 5:32774384-32774406 GCAGATGTGGGGAAGGAGGAGGG + Intronic
988665238 5:33320052-33320074 GCTGAGGCGAAGATGAAGAAGGG + Intergenic
989159387 5:38375744-38375766 GCTGAAGTGAGAAAGGAGGATGG + Intronic
989567363 5:42914680-42914702 GCTGATGGAAAAATTGAGGAGGG - Intergenic
990659884 5:58001549-58001571 CCGGATGTGAACATGGAGTAAGG - Intergenic
992304576 5:75422885-75422907 GATGATGTGAAGATATAGGGAGG + Intronic
992591819 5:78303440-78303462 GCTGCCCTGGAGATGGAGGAAGG - Intergenic
993581660 5:89669338-89669360 GATGGTGTGAAGAGGAAGGAAGG - Intergenic
993811261 5:92479499-92479521 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
994250669 5:97533171-97533193 CCAGATCTGAAGATGAAGGAGGG - Intergenic
994732532 5:103510136-103510158 GATGATGTGAATCTTGAGGATGG - Intergenic
995412404 5:111873572-111873594 CTTGCTTTGAAGATGGAGGAAGG - Intronic
995516907 5:112963324-112963346 GCTGCTTGGAAGATGGGGGAAGG + Intergenic
995647018 5:114324422-114324444 GCAGATGTGACTATGGAAGAAGG + Intergenic
996595622 5:125199355-125199377 GGGGAGGAGAAGATGGAGGAGGG - Intergenic
997128868 5:131256740-131256762 GCTGACTTGAAGATGGGGGTGGG - Intronic
997262389 5:132475067-132475089 GGGGGTGTGGAGATGGAGGAGGG + Intronic
997346030 5:133192807-133192829 GCTCATGTGACTATGGAGGCCGG - Intergenic
997654728 5:135546383-135546405 TCTGAAGTGGAGATGGGGGAGGG + Intergenic
997829359 5:137135937-137135959 GCTGATATGAACATGCAGGAGGG + Intronic
997835635 5:137190833-137190855 ACTGAGGTCAAGATGGAGCAGGG + Intronic
999146585 5:149399969-149399991 GCTACTGTGAAGAAGCAGGAAGG - Intronic
999153456 5:149441939-149441961 GCTCCTGTGCAGCTGGAGGAAGG + Intergenic
999290501 5:150422337-150422359 CCTGATGGGGAGATGGAGTAAGG + Intergenic
999458427 5:151737173-151737195 GCTGCTGTGCAGGTGAAGGAAGG + Intergenic
999943227 5:156567436-156567458 GCTCATGTGATTATGGAGGCTGG + Intronic
999966568 5:156816580-156816602 CCAGCTTTGAAGATGGAGGAAGG + Intergenic
1000257324 5:159552318-159552340 GCTTATCAGATGATGGAGGAAGG + Intergenic
1000259407 5:159572245-159572267 GCTAAAGTGAAGCTGGAGAATGG + Intergenic
1000397482 5:160790983-160791005 GTTGGTTTGAAGATGGAGGAAGG + Intronic
1000592593 5:163176557-163176579 CCTGATGTGAAAGAGGAGGAGGG + Intergenic
1000831680 5:166110046-166110068 GCTCATGTGATTATGGAGGCTGG + Intergenic
1000834112 5:166134188-166134210 TCTGATGCCATGATGGAGGAGGG + Intergenic
1001138203 5:169120424-169120446 GCTGCTTTGAAGACAGAGGAAGG + Intronic
1001658562 5:173373269-173373291 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1001848438 5:174941806-174941828 GCAAATGAGAAGATGGCGGAGGG + Intergenic
1002579389 5:180198556-180198578 CCCCATGTGAAGATGCAGGAGGG - Intronic
1003626659 6:7747411-7747433 GCACCTTTGAAGATGGAGGAAGG + Intronic
1003973159 6:11318222-11318244 GCTCATGTGATCATGGAGGCAGG - Intronic
1004002805 6:11610891-11610913 GGTGAGGTGAGGAAGGAGGAGGG + Intergenic
1004423039 6:15488385-15488407 GCGGATGTTAAAATGGAGGGGGG - Intronic
1004722023 6:18276030-18276052 GAAGAGGTGAAGAGGGAGGAGGG - Intergenic
1005494770 6:26378741-26378763 GCTGCTTTGAAGATGGAGGAAGG - Intergenic
1005503998 6:26454159-26454181 GCTGCTTTGAAGATACAGGAAGG - Intergenic
1006361173 6:33588236-33588258 GGGGATGAGAAGAAGGAGGAGGG - Intergenic
1006801297 6:36761308-36761330 GCTATTGTGAAGATGGAGTGTGG - Intronic
1009523891 6:64719084-64719106 GCTGATTTGAAGATGAAGGCGGG + Intronic
1009887853 6:69645548-69645570 CCTGCTTTGAAGATGTAGGAAGG - Intergenic
1009890753 6:69678312-69678334 GCTGATGGGAAGGGGAAGGATGG + Intronic
1010773544 6:79859944-79859966 GCTCATGTGATTATGGAGGATGG - Intergenic
1010909966 6:81541857-81541879 GCTCATGTGGACATGGAGTAAGG + Intronic
1011629700 6:89311755-89311777 GATGATGTGAAGATGGGGTGAGG - Intronic
1012040354 6:94197115-94197137 GGTGTTGTGCAGATGTAGGATGG + Intergenic
1012988167 6:105897182-105897204 GCTGATGTGTGGTTGAAGGATGG - Intergenic
1013404816 6:109833337-109833359 ACAGATATGAAGATGGAGAAAGG + Intergenic
1013409909 6:109874714-109874736 GGCCATGTGAAGATGGAGGCAGG + Intergenic
1013861439 6:114640435-114640457 GTAGTTTTGAAGATGGAGGAGGG + Intergenic
1014140861 6:117940291-117940313 GTTGAAGTGCTGATGGAGGATGG + Intronic
1014286334 6:119503201-119503223 GCTAAGGTGAATATGGAGGCTGG + Intergenic
1015284325 6:131467916-131467938 GCCTATGTGAGGGTGGAGGACGG + Intergenic
1015712523 6:136157664-136157686 TGTGATGGGAAGATGGGGGAAGG + Intronic
1016310926 6:142732709-142732731 GCTCATGTGATGATGGAGACTGG + Intergenic
1016556960 6:145349688-145349710 GTTGAGGTGGAGGTGGAGGAGGG - Intergenic
1017309866 6:152962585-152962607 ACTGAAATGAACATGGAGGAGGG - Intergenic
1017969313 6:159297817-159297839 GTTGCTTTGTAGATGGAGGAAGG - Intergenic
1018644065 6:165931545-165931567 GCAGATGTGAACATGAAAGAAGG + Intronic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1018844711 6:167547517-167547539 GATGGGGTGAAGAAGGAGGAGGG - Intergenic
1019004963 6:168789304-168789326 GCTGTGCTGAGGATGGAGGAAGG + Intergenic
1019830524 7:3323606-3323628 GCTGGTTTGAAGATGGAGTGGGG - Intronic
1019908934 7:4086559-4086581 GCTGCTCTGAAGATGAAGGAAGG - Intronic
1020053234 7:5097450-5097472 GCTGGTGAGGAGATGGAGAAAGG - Intergenic
1020509428 7:9034769-9034791 GCTTCTGTGAGGATGGAGGCAGG + Intergenic
1020727256 7:11831715-11831737 CCAGATGTGAAGATGGGGAAAGG + Intronic
1021209016 7:17821822-17821844 ATGGATGTGAATATGGAGGATGG - Intronic
1021408310 7:20299720-20299742 GCTCATGCGATGATGGAGGCTGG - Intergenic
1021413689 7:20357623-20357645 GCTGATGTGAGGATGAAGTAAGG - Intronic
1021585307 7:22201386-22201408 GCAGATGTGAGAATGGAGAAAGG + Intronic
1021629672 7:22632139-22632161 GGAGATGTGTACATGGAGGAGGG + Intronic
1021800935 7:24305657-24305679 GCTGGGGAGAAGATTGAGGAAGG + Intergenic
1022027736 7:26464629-26464651 GCTTGTGTGAAGGAGGAGGAGGG + Intergenic
1022029102 7:26476119-26476141 GCTTATGTGATTATGGAGGCTGG + Intergenic
1022104453 7:27188266-27188288 GCTGCCGTGAAGATGGATGAGGG + Intergenic
1022514680 7:30967985-30968007 GCTGGTCTGAAGATGGAGAAAGG - Intronic
1023068375 7:36402479-36402501 GCTGGTGTGAAAATTGAGGAGGG - Intronic
1024328106 7:48129060-48129082 GTTGGTGTGAACTTGGAGGAAGG + Intergenic
1024436443 7:49361942-49361964 GCAGATTTGTAGCTGGAGGATGG - Intergenic
1024502573 7:50127819-50127841 GCTGGTGAGGATATGGAGGAAGG + Intronic
1024551694 7:50567495-50567517 GCTCATGTGATTATGGAGGCTGG + Intergenic
1024907097 7:54398025-54398047 GCTTATGTTGAGATGGAGGAAGG - Intergenic
1025206337 7:56995522-56995544 GCAGACGTCATGATGGAGGATGG + Intergenic
1025665598 7:63581405-63581427 GCAGACGTCATGATGGAGGATGG - Intergenic
1026374045 7:69732279-69732301 GCTGTTGTAAAGGTGGGGGATGG + Intronic
1026739904 7:72972675-72972697 TCTGAGGTAAAGATGGAGGCTGG - Intergenic
1026797179 7:73373851-73373873 TCTGAGGTAAAGATGGAGGCTGG - Intergenic
1026846610 7:73702342-73702364 GCTGAGGTGAAGGTCCAGGAAGG - Intronic
1027103829 7:75392395-75392417 TCTGAGGTAAAGATGGAGGCTGG + Intergenic
1027713812 7:81643600-81643622 ACTGATGTTAAGATTGATGATGG + Intergenic
1027793781 7:82666198-82666220 TCTGCTCTGATGATGGAGGATGG - Intergenic
1027940199 7:84668643-84668665 GATGAAGTAAAGATTGAGGAAGG + Intergenic
1028104919 7:86865840-86865862 GGTGATGTGAAGATGGAGGCAGG - Intergenic
1028654515 7:93188331-93188353 GCTTCTGTGAAAATGCAGGAAGG + Intergenic
1028676080 7:93462535-93462557 GCTGTTGTGACTATGAAGGATGG - Intronic
1030164193 7:106536449-106536471 GATGGTGTGAAGATGGAGGGAGG + Intergenic
1031356103 7:120789041-120789063 GCTGATGAGAAGAAGGAGAGAGG + Intronic
1033552066 7:142456587-142456609 GCTGATGTGATTATGGATCATGG + Intergenic
1034077393 7:148245423-148245445 GCTGATGTGGAGGAGGATGAAGG + Intronic
1034140331 7:148809826-148809848 GATTATGTGAAAATGGAGGTAGG - Intronic
1034198251 7:149264371-149264393 GCTGATGTGAAGTTGGAGGAGGG + Intronic
1034326599 7:150240388-150240410 GCTGATGAGAAGTTGGAAGTTGG + Intergenic
1034766612 7:153728885-153728907 GCTGATGAGAAGTTGGAAGTTGG - Intergenic
1035383318 7:158454195-158454217 ACTGATGTGAGGATTGGGGATGG + Intronic
1035383330 7:158454317-158454339 ACTGATGTGAGGATTGGGGACGG + Intronic
1035383342 7:158454439-158454461 ACTGATGTGAGGATTGGGGACGG + Intronic
1035383354 7:158454561-158454583 ACTGATGTGAGGATTGGGGACGG + Intronic
1036092513 8:5682679-5682701 AGTGATGTGAATATGCAGGAAGG - Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1036526973 8:9544131-9544153 GCTTATGTGATCATGGAGAATGG + Intergenic
1038049122 8:23792546-23792568 GCTGGGTTTAAGATGGAGGAAGG - Intergenic
1038671373 8:29585764-29585786 GGTGATGGGAAGATGGAGGCAGG + Intergenic
1039046269 8:33453235-33453257 GGTCATGTGATGATGGAGGTAGG + Exonic
1039771099 8:40687722-40687744 GCTGATGAGAAGGTGAGGGAAGG - Intronic
1039817463 8:41107141-41107163 GCTGATTTGAGGACAGAGGAGGG + Intergenic
1040564374 8:48552910-48552932 GCCCATGGGAAGCTGGAGGACGG + Intergenic
1040692489 8:49956878-49956900 GCTGAAATAAAGCTGGAGGAGGG - Intronic
1040902735 8:52433564-52433586 TGTGCTTTGAAGATGGAGGAGGG - Intronic
1041674685 8:60526354-60526376 TTGGTTGTGAAGATGGAGGAAGG - Intronic
1042216717 8:66435447-66435469 CCAGCTGTGAAGATGGAGGAAGG - Intronic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1043968644 8:86506777-86506799 GTTGACGTGAAGTTGGAAGAAGG - Intronic
1044371330 8:91414821-91414843 GCTGAGTAGAAGATGGAGGCGGG + Intergenic
1044424638 8:92037234-92037256 GCTGATGTTGAGAAGGAGGGAGG + Intronic
1044846790 8:96389732-96389754 CCTAATGTGAAGATGGGGAAGGG - Intergenic
1045252483 8:100493459-100493481 GTGGGTGTGAAGAGGGAGGAGGG + Intergenic
1045322525 8:101092569-101092591 GCAGCTGTGAGGAAGGAGGATGG - Intergenic
1045504531 8:102769179-102769201 TCTGATTTGAAGGAGGAGGATGG - Intergenic
1045826619 8:106405245-106405267 GCTCATGTGATTATGGAGGCTGG + Intronic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047370807 8:124254256-124254278 GCTGGAGTGAAGATGGAAGACGG + Intergenic
1047557674 8:125950279-125950301 GCTGAAGGGAACATGGAAGATGG + Intergenic
1047781139 8:128112087-128112109 GATGAAGTGAAGATGGGTGAAGG - Intergenic
1048237770 8:132708849-132708871 AGTGGTTTGAAGATGGAGGAGGG + Intronic
1048879360 8:138859977-138859999 TCTGATGAGGAAATGGAGGATGG - Intronic
1049049846 8:140185770-140185792 GCTGATGGGGAGATGGGGAAGGG + Intronic
1049350698 8:142163007-142163029 ATTGATGTATAGATGGAGGATGG + Intergenic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1049452808 8:142671283-142671305 TGTGCTTTGAAGATGGAGGAAGG + Intronic
1050610442 9:7346884-7346906 GCTGATTGAAGGATGGAGGATGG - Intergenic
1050903461 9:10974749-10974771 GCTGCTGTGGTGATGGGGGATGG - Intergenic
1050951162 9:11596209-11596231 ACTCATGTAGAGATGGAGGAGGG + Intergenic
1051097863 9:13487185-13487207 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1051432864 9:16998428-16998450 GCTGCTCTAAAGATGGAGGCAGG + Intergenic
1051593805 9:18803339-18803361 CTGGTTGTGAAGATGGAGGAAGG - Intronic
1052263672 9:26547287-26547309 GCAGATGTGAAGAAATAGGAAGG + Intergenic
1052802507 9:32982826-32982848 GCTGATTTGAAAATTTAGGAGGG - Intronic
1052926371 9:34020231-34020253 ACAGATGTGGAGATGGAAGACGG - Intronic
1053011583 9:34636861-34636883 GCTTATGGGAGGGTGGAGGAAGG + Intronic
1053404347 9:37858901-37858923 GCTGAGGTGTAGATGGAGTGGGG - Intronic
1054960348 9:70961186-70961208 TGTGCTTTGAAGATGGAGGAAGG + Intronic
1055766066 9:79664741-79664763 GCTGAAGTCTAGAAGGAGGATGG - Intronic
1056197781 9:84245354-84245376 GCTCACGTGATGATGGAGGCTGG + Intergenic
1056493885 9:87136528-87136550 GCTGCTTTGAGGATGGGGGAAGG + Intergenic
1056564826 9:87761869-87761891 GCAGATGTGAAGAGAGAGCACGG + Intergenic
1058263820 9:102873010-102873032 GCTGATGTAAATATGCTGGATGG + Intergenic
1058288726 9:103211138-103211160 TCTCATGTCAAGTTGGAGGAGGG - Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058441992 9:105017920-105017942 TGTGCTTTGAAGATGGAGGAAGG - Intergenic
1058621465 9:106887927-106887949 GCTGTTGTGAAGATGAATGTGGG + Intronic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1059075974 9:111194427-111194449 GGTGATTTGACAATGGAGGAAGG - Intergenic
1059450347 9:114367810-114367832 GCTGATGTGAAGATCGCACATGG - Intronic
1059973622 9:119693007-119693029 GCTGCAGTGAAGATGGAGGTGGG + Intergenic
1059990176 9:119857976-119857998 GCTGCTTTGAAGATGAAGGAAGG - Intergenic
1060940456 9:127540348-127540370 GCTGAGCTGAGAATGGAGGAAGG + Intronic
1061035795 9:128113782-128113804 GCTGGCTTGAAGGTGGAGGAAGG + Intergenic
1061244844 9:129396243-129396265 GATGAAGTGTGGATGGAGGACGG + Intergenic
1061384401 9:130279995-130280017 GCTGCTTTGAAGATGGAGGAAGG + Intergenic
1062173974 9:135150794-135150816 TCAGCTTTGAAGATGGAGGAGGG - Intergenic
1062215905 9:135389771-135389793 GCTCATATGAAGAAGGAGGGGGG + Intergenic
1062296175 9:135828328-135828350 TGTGTTGTGAACATGGAGGAGGG + Intronic
1062404687 9:136389827-136389849 GCTGGAGTGAAGCTGGAGGGAGG + Intronic
1062520757 9:136956959-136956981 GATGATGGGTAGATGGTGGATGG + Intronic
1062520780 9:136957047-136957069 GATGATGGGTAGATGGTGGATGG + Intronic
1203530845 Un_GL000213v1:140426-140448 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1185612143 X:1399075-1399097 GCTGATGTGGGAAGGGAGGAAGG + Intergenic
1186024145 X:5290333-5290355 GCTTATTGGAAGATGGAGGATGG + Intergenic
1186331202 X:8536059-8536081 GCTCTTTTGAAGATGGAGGCAGG + Intronic
1186424785 X:9455411-9455433 GCTGGCTTGAAGATGGAGGAAGG + Intergenic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186630155 X:11340012-11340034 GCAGCTGTGGAGATGGAGAAGGG - Intronic
1187504077 X:19864540-19864562 GTGGCTTTGAAGATGGAGGAAGG + Intronic
1187551136 X:20306935-20306957 GCTGTTGGGAAGATGGACCAGGG + Intergenic
1187887962 X:23907279-23907301 CCTGATGTGTGGATGGGGGAGGG - Intronic
1188028496 X:25236710-25236732 GCTGATGTGATTAGGAAGGAGGG + Intergenic
1188819073 X:34751387-34751409 GCCTATTTGAAGATGGAGGGTGG - Intergenic
1188938666 X:36209897-36209919 GCTGATGGGATGGTGGAGGATGG - Intergenic
1188945465 X:36295151-36295173 GCGCATGTGAAGATGAAAGAAGG + Intronic
1188990038 X:36807175-36807197 GCTGCTTTGGAGATGCAGGAAGG - Intergenic
1189064221 X:37789134-37789156 GCTGGTTGGAAGGTGGAGGAGGG - Intronic
1189889637 X:45586902-45586924 GATGATGGGAAAAGGGAGGATGG - Intergenic
1190166088 X:48073979-48074001 TCAGCTTTGAAGATGGAGGAAGG - Intergenic
1190250805 X:48723703-48723725 TCCGCTGTGAAGATGGAGAAAGG - Intergenic
1190767332 X:53486355-53486377 GCTCATGTGATTATGGAGGCTGG + Intergenic
1192207762 X:69107454-69107476 GCTGCTGAGTAGGTGGAGGAGGG + Intergenic
1192268101 X:69554308-69554330 GCTGCTTTGAAAATGGAGGAAGG + Intergenic
1192775514 X:74240437-74240459 GGTGATGTGAAGATGGCTGCTGG + Intergenic
1194894120 X:99417729-99417751 GATTATTTGAGGATGGAGGATGG + Intergenic
1195272550 X:103246317-103246339 GGTGGTGTGAGGATGTAGGAAGG - Intergenic
1195705564 X:107735698-107735720 GCTGAGGGGAAGAAGGAGAAGGG - Intronic
1196027325 X:111054790-111054812 GCTGAGGTGATGGTGGAGGCAGG - Intronic
1196628285 X:117904390-117904412 TCTGATGGGAAGAGGGAGTAAGG + Intronic
1196685879 X:118509884-118509906 GCTGGTTTGAGGAGGGAGGAAGG - Intronic
1198333100 X:135640422-135640444 CCTGAAGAGAAGATGGAAGATGG - Intergenic
1198521309 X:137455511-137455533 GCTGATGGGAAGCAGAAGGATGG + Intergenic
1198582772 X:138084874-138084896 AATGATGTGAAGATGCAGCAGGG + Intergenic
1199108412 X:143900453-143900475 GCTGATGAGAATGTGGAGAAAGG + Intergenic
1199681612 X:150228489-150228511 TGTGCTTTGAAGATGGAGGAGGG - Intergenic
1200072844 X:153537523-153537545 GGAGGAGTGAAGATGGAGGAGGG + Intronic
1200084557 X:153597467-153597489 GAAGCTTTGAAGATGGAGGAAGG - Intronic
1201578643 Y:15488065-15488087 CCAGCTTTGAAGATGGAGGAAGG - Intergenic
1201735799 Y:17260211-17260233 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
1202167230 Y:22002798-22002820 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202318985 Y:23612089-23612111 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202551784 Y:26057968-26057990 GTTGCTGGGCAGATGGAGGATGG - Intergenic