ID: 1128647042

View in Genome Browser
Species Human (GRCh38)
Location 15:69385230-69385252
Sequence CTACATCTACTGTATCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128647042 Original CRISPR CTACATCTACTGTATCTGCA TGG (reversed) Intronic
901437083 1:9253722-9253744 CTAAATCTGCTGAATCTGAAGGG - Intronic
901720498 1:11193473-11193495 ACACATCTACTGGCTCTGCAGGG + Intronic
904617367 1:31757096-31757118 CAACAACTACTGTTTCTTCAGGG - Intronic
905470389 1:38187465-38187487 CTATGTCTGCTGCATCTGCAGGG - Intergenic
907109071 1:51909930-51909952 CGGCATCTACTGTGTGTGCACGG + Exonic
907543240 1:55235574-55235596 TTATGTCTACTGTATCTGTATGG + Intergenic
908652092 1:66345562-66345584 CTACAGCTAGTGTAACTGCTGGG - Intronic
912169551 1:107081887-107081909 CTACATCTACAGTACCCTCATGG - Intergenic
912880191 1:113404514-113404536 TTATATCTACTATATCTGTATGG + Intronic
913207552 1:116554852-116554874 CTACCTCTACTTTGTGTGCATGG + Intronic
917332115 1:173891862-173891884 CTCCCTATACTGTATCAGCATGG - Exonic
918594103 1:186273163-186273185 TTAGATCAAATGTATCTGCACGG + Intergenic
922798227 1:228352003-228352025 CTCCAGCCACTGTGTCTGCAGGG + Intronic
1063433717 10:6013689-6013711 TTACATCTATTGTGTCCGCATGG - Intronic
1065057013 10:21856420-21856442 TTATATCTATTGTAGCTGCATGG + Intronic
1067931349 10:50565397-50565419 TGACTTCTACTGTATCTGCTTGG + Intronic
1069910548 10:71756268-71756290 CTGCGTCTGCTGTATTTGCAGGG - Intronic
1073772812 10:106753825-106753847 CTACCTCCAGTGTATCTTCATGG - Intronic
1075608318 10:123832224-123832246 CTGCATCTCCTGCATCTGAACGG + Intronic
1075672372 10:124271199-124271221 CTACATTCCCTGTAGCTGCATGG - Intergenic
1078805347 11:14694733-14694755 CCACATTTACAGTATCTCCAAGG + Intronic
1085956283 11:81400108-81400130 CTACATCTTCTGTTTCTGCAAGG - Intergenic
1089501565 11:118934776-118934798 ATACATCTGCTTTATCTGCAGGG + Intronic
1090045188 11:123325518-123325540 TTTCATCTAGTGTATTTGCAGGG - Intergenic
1090851481 11:130574521-130574543 TTACGTCTAGTGTATCTGCCTGG - Intergenic
1091145660 11:133277653-133277675 ATACATGTACTGGATCTGAAAGG - Intronic
1091867910 12:3858330-3858352 CTACAGCCACTTTCTCTGCATGG - Intronic
1091929444 12:4383062-4383084 TTAGACCTACTGAATCTGCAGGG + Intergenic
1094048414 12:26193745-26193767 CTATTTCTACTGCCTCTGCATGG + Intronic
1094132172 12:27085888-27085910 CTACCTCCACTCTAGCTGCATGG - Intergenic
1097366853 12:58725105-58725127 CAACATCTTCTTTATTTGCATGG - Intronic
1099316647 12:81091933-81091955 CTAGATCTGCTATCTCTGCATGG - Intronic
1100271996 12:93034745-93034767 CTCCCACTACTGCATCTGCAGGG - Intergenic
1102440488 12:112960255-112960277 CCAAATTTACAGTATCTGCATGG - Intronic
1102709626 12:114914736-114914758 CTACATGCCTTGTATCTGCAGGG + Intergenic
1106860597 13:33903354-33903376 TTACACCTACTGTTTCTGTATGG - Intronic
1110777308 13:79422882-79422904 TTACATCGACTGCATCTGTATGG - Intergenic
1111618192 13:90689195-90689217 CTAGTTCTACTGTGTCTTCAAGG - Intergenic
1111811828 13:93100783-93100805 CTTTATCTTCTGTAGCTGCAGGG - Intergenic
1117106940 14:52407519-52407541 GTACGTCTACTGTCTCTGCTTGG - Intergenic
1121103572 14:91265778-91265800 TTACACCTATTGTATCTGTATGG + Intergenic
1125035260 15:35116269-35116291 CTGCATCTTCTGTATATTCAAGG - Intergenic
1127254059 15:57273371-57273393 CTTCTTCTACTGTATCATCAGGG + Intronic
1128198809 15:65786261-65786283 CTACACCTACAGTATCAACAAGG + Intronic
1128647042 15:69385230-69385252 CTACATCTACTGTATCTGCATGG - Intronic
1128773209 15:70298947-70298969 TTACATCTATTGTATATGTATGG + Intergenic
1129108832 15:73325742-73325764 GGACATCAACTGTATCTCCAGGG + Intronic
1130737766 15:86568575-86568597 CTAAATCTTCTGTGACTGCATGG + Intronic
1135354966 16:21761378-21761400 CTCCTTCTACTCTATCTCCATGG + Intergenic
1135453450 16:22577520-22577542 CTCCTTCTACTCTATCTCCATGG + Intergenic
1135465666 16:22682654-22682676 TTATGTCTACTGTGTCTGCATGG + Intergenic
1136414121 16:30093218-30093240 ACACATCTACAGTATCTGCTTGG + Intronic
1137470232 16:48747905-48747927 CTACAGCTACTGAATATACATGG - Intergenic
1139062482 16:63270174-63270196 CTCCTACTACTGTCTCTGCAAGG - Intergenic
1144845513 17:18216471-18216493 TTACATCTATTGTATCTGTATGG - Intergenic
1145190142 17:20833779-20833801 CTGCGTTTAATGTATCTGCATGG + Intergenic
1145401343 17:22537652-22537674 CTGCCTTTAATGTATCTGCATGG + Intergenic
1146749198 17:35362246-35362268 TTACATCTATTGTATCTGTGTGG - Intronic
1150597670 17:66620758-66620780 GTACATTGACTGTATCTGGAGGG + Intronic
1150812249 17:68365821-68365843 TTACATCTATTGTATCTGTGTGG - Intronic
1151386685 17:73759384-73759406 CTGCACCTTCAGTATCTGCAGGG + Intergenic
1152478651 17:80535391-80535413 CTAGATCCATTGTATCAGCAAGG - Intergenic
1153326141 18:3822370-3822392 AAACATTTACAGTATCTGCAGGG + Intronic
1154354214 18:13612498-13612520 CTCTCTCTACTGTATCAGCAGGG - Intronic
1157814761 18:50722528-50722550 CTCCCTCTACTGTATATTCAAGG + Intronic
1159063828 18:63546113-63546135 CTACACCTAATGTATTTGTAGGG + Intergenic
1163786884 19:19279376-19279398 GTACATCTGCTGCATCTGCAGGG + Exonic
1166145267 19:40830207-40830229 CTATATCCACTGTATCTGTCAGG + Intronic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
925575261 2:5353584-5353606 CAACATCTACTGAAGCTGAAAGG + Intergenic
927005966 2:18849114-18849136 CTATATATACTGTATATACAGGG - Intergenic
927285325 2:21351435-21351457 CAACATCCACAGAATCTGCAAGG - Intergenic
928989344 2:37215972-37215994 TTAAATCTACTGTATCTGACTGG - Intronic
929292273 2:40207219-40207241 CTACATCTACTTTATTTCCTAGG + Intronic
929441712 2:41970402-41970424 CTACATATACCCTCTCTGCATGG + Intergenic
931392496 2:61856053-61856075 TTGCATCTACTGTATCTGTATGG - Intergenic
935588856 2:104826549-104826571 CTGCATCTACTGTGTCTACTGGG + Intergenic
939330627 2:140754989-140755011 CTGTATCTACTGTATCAGTAGGG - Intronic
939698667 2:145361317-145361339 CTTCATCTACTTTATCCTCAAGG - Intergenic
941581665 2:167304174-167304196 CTTTATCTCCTGTATCTGCAGGG - Intergenic
945594231 2:211772094-211772116 TTACATCTACTGAACCTGTATGG + Intronic
946409545 2:219509261-219509283 CCACATCTGCTGCATCCGCACGG + Intergenic
1169970055 20:11260330-11260352 TTACATCAATTGTATCTGCATGG + Intergenic
1171263695 20:23753316-23753338 GTACACCTGCTGTATCTGCCGGG - Intergenic
1172319461 20:33984992-33985014 CTACATTTCCTGTCTCTCCAAGG + Intergenic
1174512043 20:51060768-51060790 TAACATCCACTTTATCTGCAAGG - Intergenic
1178592570 21:33924000-33924022 ATAGACCTCCTGTATCTGCAAGG + Intergenic
1183430074 22:37760458-37760480 TCACATCTACTGTATCCGCATGG - Intronic
952047575 3:29342027-29342049 CTACTCCAACTGTATCTCCAGGG - Intronic
952916688 3:38251395-38251417 CACCCTCTGCTGTATCTGCAAGG - Exonic
953514460 3:43576589-43576611 CAACATCTATTTTCTCTGCAAGG + Intronic
955414827 3:58682474-58682496 TTACATATAGTGTATCTGCATGG - Intergenic
962372059 3:134828872-134828894 CAAGATTTCCTGTATCTGCAGGG + Intronic
962440623 3:135412332-135412354 CTGCATCTATTTTATCTGCATGG - Intergenic
969929484 4:10616152-10616174 CTACATCTATTTTATCTGAATGG + Intronic
970186685 4:13462337-13462359 TTACATCTGCTGTATCTATATGG - Intronic
976712384 4:88086142-88086164 CTAGTTCTACTGAATGTGCATGG - Intergenic
977939034 4:102838281-102838303 TTATGTCTATTGTATCTGCATGG + Intronic
979829122 4:125278829-125278851 CTTCATCCAATGTATCTGCCCGG + Intergenic
984049431 4:174845342-174845364 CTACATTCACTGAATCTCCAGGG - Intronic
984100875 4:175484410-175484432 CGTCATCTCCTGTCTCTGCATGG - Intergenic
984450963 4:179900891-179900913 CTGCCTGTACTGTAGCTGCAAGG - Intergenic
984557389 4:181231149-181231171 TTACATCTACTCTCTCTGCATGG - Intergenic
986226639 5:5821729-5821751 CTACATATATTGTCACTGCAGGG - Intergenic
987993287 5:25243298-25243320 CTTCATCAAATGTGTCTGCACGG - Intergenic
988025584 5:25683866-25683888 TTAAATCTATTGTATCTGTATGG + Intergenic
989324541 5:40176209-40176231 CCAAATCTACAGTATCTCCAAGG - Intergenic
992392955 5:76346178-76346200 TTACACCTATTGTATCTGTATGG - Intronic
993176165 5:84488708-84488730 CTACATCTATCGTTTCTGTATGG - Intergenic
993464150 5:88224277-88224299 CTAGATTTACTGAATCTTCAAGG + Intronic
995256799 5:110056207-110056229 ATACAGCTACTGTAGCTTCATGG - Intergenic
995310570 5:110705683-110705705 ACACATATACTGTATATGCAGGG - Intronic
995831074 5:116357053-116357075 TCACATCTACTCTATCTGCCTGG + Intronic
1000370720 5:160533820-160533842 CTACATCAAATGTATCTGGAGGG - Intergenic
1000757665 5:165181638-165181660 CTGCTTTTACTGTATCTGCTAGG + Intergenic
1002564500 5:180102199-180102221 CTACACCTGCTATATCTGCGTGG + Intronic
1004706349 6:18127501-18127523 CTACACCTACTCTTTCTGAAAGG - Intergenic
1006828857 6:36956723-36956745 CTACAACCACTGTAGCTACAAGG - Intronic
1009963182 6:70549476-70549498 CCACATCCACAGTATCTCCAAGG - Intronic
1012097540 6:94982440-94982462 TTACATCTATTGTACCTGTATGG - Intergenic
1015812876 6:137178919-137178941 CTGCACCTACTGTGTCTCCATGG - Intergenic
1015947510 6:138517943-138517965 ATACCTGTACTGTAGCTGCAAGG + Intronic
1016794944 6:148107895-148107917 CTACATCCACAGTATCTGTGTGG + Intergenic
1016989143 6:149917491-149917513 CTTCAGCTCCTGTCTCTGCATGG + Intronic
1018080288 6:160253780-160253802 TTACATCTACTGTATCTGCATGG + Intronic
1018364817 6:163108788-163108810 CTACATTTCCTGTATTTGTATGG - Intronic
1018955467 6:168407187-168407209 CTTCATCTCCTGTAGCTACAGGG - Intergenic
1022786414 7:33642061-33642083 CTACATTTTATGTATCTGCAGGG - Intergenic
1025845387 7:65192184-65192206 CTTCATCTACTGTATCTTCCTGG - Intergenic
1025895663 7:65698216-65698238 CTTCATCTACTGTATCTTCCTGG - Intergenic
1026117500 7:67508356-67508378 TTTCATCTGCTGAATCTGCATGG + Intergenic
1031046337 7:116892532-116892554 CTATATGTAATGTATCTCCAAGG - Intronic
1032435002 7:131893374-131893396 CTCCATCTACTTTCTCTGCCTGG + Intergenic
1033952333 7:146800492-146800514 ATACCTCTACTCTAGCTGCAAGG + Intronic
1034132515 7:148733161-148733183 CTTCAGCTACTGTATTTGAATGG + Intronic
1034309717 7:150076603-150076625 CTACATCCACTCAATCTGCCAGG - Intergenic
1034797137 7:154024039-154024061 CTACATCCACTCAATCTGCCAGG + Intronic
1036198943 8:6750011-6750033 CTTCAACTACTGAATATGCATGG - Intronic
1041032801 8:53755206-53755228 CTACCTCCCCTGTATCTCCAGGG + Intronic
1041308153 8:56485040-56485062 GTACATCTACTTTATCTTCTGGG - Intergenic
1043927872 8:86058305-86058327 CTACATCTACTGTATTCACTGGG - Intronic
1045485213 8:102625940-102625962 CTACATCTACAGATTCTTCAGGG - Intergenic
1045488337 8:102651537-102651559 CTCCACCTGCAGTATCTGCAGGG - Exonic
1045852596 8:106720631-106720653 CAACATCAATTGTATCTGCATGG - Intronic
1047565105 8:126035384-126035406 CCTTATCTACTGTAGCTGCAGGG - Intergenic
1048248614 8:132837780-132837802 GTACATCTGCTATATCTGCCGGG + Exonic
1051074605 9:13216455-13216477 CTACCTCTGGAGTATCTGCAAGG + Intronic
1051514286 9:17910971-17910993 CTATAGCTACAGTATCTACACGG - Intergenic
1052101328 9:24449190-24449212 CTTTATCTCCTGTAGCTGCAGGG - Intergenic
1052304978 9:26997862-26997884 CTAAAACTTCTGAATCTGCAAGG - Exonic
1052421612 9:28250248-28250270 CTACATCCACTTTATCTTCCTGG - Intronic
1053318271 9:37071501-37071523 CTTCAACAACTCTATCTGCATGG - Intergenic
1056058331 9:82853135-82853157 CTACACCCACAGTATCTCCAAGG - Intergenic
1056749748 9:89339513-89339535 GTAAATCTACTGAATCTGGATGG + Intronic
1057734775 9:97646154-97646176 CTAAATATACTGTATGTGCTAGG - Intronic
1060069884 9:120536943-120536965 GTACATTTTCTGTATCTCCAAGG + Intronic
1186790172 X:12989878-12989900 TTACATCTACTATATCTGTATGG + Intergenic
1186995181 X:15113883-15113905 TTACATCTATTTTATCTGTATGG + Intergenic
1187333263 X:18360020-18360042 CTACATCTTCTGTTTCTGCTGGG + Intergenic
1187892550 X:23949925-23949947 TTATATCTATTGTATCTGTATGG + Intergenic
1189070057 X:37853981-37854003 CTACATCTACTATATTTCCAGGG + Intronic
1190856939 X:54305264-54305286 TTACAGCTACTCTATCTGCATGG + Intronic
1192579020 X:72265448-72265470 TCACACCTGCTGTATCTGCATGG + Intronic
1193872339 X:86815289-86815311 CTCCATTTACAGGATCTGCAGGG - Intronic
1195023153 X:100849402-100849424 CTATTTCTACTGGATCTGCAGGG - Exonic
1195067581 X:101251545-101251567 TAACATCTATTGTATCTGCATGG - Intronic
1195982441 X:110593698-110593720 TTACATCTATTGTATCTGAATGG - Intergenic
1196067063 X:111475318-111475340 CTAAATCTACAATGTCTGCAAGG - Intergenic
1196510600 X:116506614-116506636 ATACATCTACTTTATCTCCCTGG + Intergenic
1198226371 X:134649364-134649386 TTACATCTATTGTATCTGTATGG + Intronic
1198968321 X:142250994-142251016 CTACAGCTACAGTTTCTCCAAGG - Intergenic
1200043529 X:153387597-153387619 CTTCATCCACTCTACCTGCAGGG - Intergenic
1201391456 Y:13502018-13502040 CTGCAGCTGCTGTCTCTGCAAGG + Intergenic