ID: 1128647097

View in Genome Browser
Species Human (GRCh38)
Location 15:69385715-69385737
Sequence GTGTATATGAAGAAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 498}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128647097 Original CRISPR GTGTATATGAAGAAAGAGGA TGG (reversed) Intronic
900703876 1:4063848-4063870 GAGAAAATGAAGAAAGGGGAGGG + Intergenic
901269636 1:7941983-7942005 GAGTATAAGGAGAAAGAAGAGGG + Intronic
901300418 1:8196337-8196359 TTGGCTAGGAAGAAAGAGGAAGG + Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
905636551 1:39557701-39557723 GTGTATAGTAAGAATCAGGAGGG - Intergenic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
906383619 1:45348371-45348393 GTGTTTCTGAGGAAGGAGGAAGG - Intronic
906724905 1:48037108-48037130 GTGTGTATGTGGAAAGGGGAGGG - Intergenic
908450009 1:64244706-64244728 GAGAATATGGAGAGAGAGGATGG - Intronic
908650379 1:66326466-66326488 ATGTATATGAAAAAATAGTATGG - Intronic
908800128 1:67871513-67871535 GTGTGTGTGAAGGAAAAGGAAGG - Intergenic
909055874 1:70820520-70820542 GGGCATATGGAGAAAGAGGAAGG + Intergenic
909556891 1:76963970-76963992 ATGTTTTTGAAGATAGAGGAGGG + Intronic
911204984 1:95083277-95083299 CTTTATATGAAGAAAAAGCATGG + Intergenic
912957064 1:114162315-114162337 TTGTATATGGTGAAAGAGAAGGG - Intergenic
913241333 1:116832602-116832624 ATGTAAAGGAAGAAAGGGGAGGG - Intergenic
913440242 1:118889366-118889388 TTGTAAATGATCAAAGAGGATGG - Intronic
913498335 1:119448478-119448500 GTGTATATTAATACAGAGAATGG + Intergenic
913509368 1:119548126-119548148 GTGTATATGAATACAGACAATGG + Intergenic
915636222 1:157189039-157189061 GTGGAGATGAAGCAAGCGGAGGG + Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916549684 1:165838215-165838237 GTGTACACAAAGAAAGAAGAGGG - Intronic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
917526746 1:175795066-175795088 GTGTAGATGAAGAGGAAGGAAGG + Intergenic
920086164 1:203418857-203418879 GTGAATATTAAAAAAGAGGCAGG + Intergenic
920206977 1:204299350-204299372 GAGGACAGGAAGAAAGAGGAGGG + Intronic
920946854 1:210537417-210537439 GTGTCTATGAAGTGAGAAGAGGG - Intronic
921116888 1:212100361-212100383 GAGTATTTGAAGGAAGAGGGAGG - Exonic
921171087 1:212550323-212550345 GAATAAATTAAGAAAGAGGAAGG - Intergenic
921482885 1:215683711-215683733 GTGAATAAGAAGAAAGAGAAAGG - Intronic
923469149 1:234274951-234274973 TGGTATATGAAGAAAGAAGTAGG - Intronic
923749698 1:236736247-236736269 GTGAATATGCAGAAAGCTGAGGG - Intronic
923774802 1:236968679-236968701 GTGAATATGAAGAAAGAGACCGG - Intergenic
923927983 1:238657902-238657924 GTGGATAGGAGGAAAGAGGAGGG + Intergenic
924256966 1:242192318-242192340 GTGGATGTGAGAAAAGAGGAGGG - Intronic
924293240 1:242559673-242559695 GTTTATCTCAAGAAAGAAGAAGG + Intergenic
924696705 1:246407959-246407981 GTGTAAATGAAGAAACCTGAGGG + Intronic
1063045218 10:2384890-2384912 GTTGATCTGAAGAAAGAGAATGG - Intergenic
1063865456 10:10360443-10360465 ATGCATGTGAAAAAAGAGGAAGG + Intergenic
1063987423 10:11520182-11520204 GAGTATATGAAGAAAAGGGACGG + Intronic
1064053387 10:12077679-12077701 ATGTCAATGAAGAATGAGGAGGG + Intronic
1064084924 10:12338298-12338320 GTGTTTCTGAAAAAGGAGGAAGG - Intergenic
1064301427 10:14126507-14126529 GTGCCTATGGAGAAAGCGGAGGG - Intronic
1064700955 10:18021142-18021164 TTGTATATGGTGAAAGGGGAGGG + Intronic
1064836504 10:19537513-19537535 GAATATCTGGAGAAAGAGGAGGG - Intronic
1065798530 10:29329707-29329729 GTGTGTGTGAAGAGAGAGAAGGG + Intergenic
1066345729 10:34584217-34584239 GTCTACATGGACAAAGAGGAAGG - Intronic
1066516969 10:36173361-36173383 GTCTAAATGAAAAAAGAGGAAGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1066965299 10:42258403-42258425 GAGGATATGGAGAAATAGGAAGG - Intergenic
1067302445 10:45024412-45024434 GTGTATTGGAATCAAGAGGAAGG + Intergenic
1069727949 10:70593253-70593275 GTGTATATGGAGGGAGATGATGG + Intergenic
1070408894 10:76121221-76121243 GTGAGTAGAAAGAAAGAGGAAGG + Intronic
1070524454 10:77283207-77283229 GTGTATGTGAAGAAAGAAAATGG - Intronic
1071001527 10:80836408-80836430 GAGGATGTGAAGAAATAGGAAGG - Intergenic
1071369977 10:84941230-84941252 GTGTCTAAGAGGAGAGAGGAAGG + Intergenic
1072196414 10:93120413-93120435 GTCTTTCTGAAGAGAGAGGAGGG + Intergenic
1074084067 10:110194217-110194239 GGGGATTTGGAGAAAGAGGATGG + Intergenic
1074402550 10:113153876-113153898 AAGTATGAGAAGAAAGAGGAAGG - Intronic
1074834088 10:117272528-117272550 GTTTAAATGGGGAAAGAGGAGGG - Intronic
1075204837 10:120437853-120437875 CTGAACATGATGAAAGAGGAAGG - Intergenic
1075956561 10:126528372-126528394 GTGTGTGGGAAGAAAGAGCAAGG + Intronic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG + Intronic
1076923576 10:133468337-133468359 GTTTTTAAGAAAAAAGAGGAAGG - Intergenic
1078090484 11:8261915-8261937 GTGTGTAGGAAGAGAGAGGATGG - Intronic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1078477796 11:11647439-11647461 GAGTAAATCAAGAAAGATGAAGG + Intergenic
1079247549 11:18763921-18763943 GTGTGGAGGAAGAAAGAGCATGG - Intronic
1079723678 11:23851550-23851572 GTGTAGACAAGGAAAGAGGATGG - Intergenic
1080328338 11:31106100-31106122 GTGTTTCTGAAGAAAGAAAAAGG - Intronic
1080369026 11:31612615-31612637 GTATATAAGGAGAAAGAGAAGGG + Intronic
1081173818 11:39901488-39901510 GGGCATATGAAAAAAGAGGAAGG - Intergenic
1081180547 11:39980933-39980955 TTGTATATGATGAAAAAGAAGGG + Intergenic
1081655079 11:44851648-44851670 ATGTATGAGAAGAGAGAGGAGGG - Intronic
1082713109 11:56578642-56578664 GTGTACATGAATAAACAGGCAGG - Intergenic
1083248113 11:61445803-61445825 GTGTATATTTAGAAGAAGGATGG + Intronic
1083459321 11:62800125-62800147 GTGTTCAGGAAGAAAGAGAAAGG + Intronic
1084241865 11:67826706-67826728 GTGTTTATGCAAAAAGAGGTTGG - Intergenic
1085728687 11:78977716-78977738 GAGGATGTGGAGAAAGAGGAAGG + Intronic
1085742840 11:79091782-79091804 GTATATTTGAAAAAAGAGGGTGG - Intronic
1086482531 11:87258358-87258380 ATGTATAAGAGGAAAGAGGCTGG - Intronic
1086667572 11:89502136-89502158 GTATTTATGAAGAAAGATGAGGG + Intergenic
1086919738 11:92572765-92572787 GTGTATATTATGGAAGATGAAGG - Intronic
1086923239 11:92611697-92611719 GAGTATATCAAGAAATAGAAGGG - Intronic
1087076403 11:94130203-94130225 GTGTTTATGAACCAACAGGAAGG + Intronic
1088084034 11:105956613-105956635 GTATATATGCAGTAACAGGATGG + Intronic
1089060859 11:115624975-115624997 GTGAAAATGGTGAAAGAGGACGG - Intergenic
1089081378 11:115778870-115778892 GAGAAAATGAAGCAAGAGGAAGG - Intergenic
1089346219 11:117793416-117793438 TTGTAGATGAAGAGAGGGGAGGG - Intronic
1089917987 11:122177640-122177662 GGGTAGATGAAGAAAGAGTGTGG + Intergenic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1090944177 11:131414753-131414775 TTGTAAATGAAGAAATAGGCAGG - Intronic
1091164885 11:133466774-133466796 GTGAAGAGGAAGAAAGAAGAAGG + Intronic
1091510443 12:1118834-1118856 GTATATATGAAAAAAGAACATGG + Intronic
1091691066 12:2597878-2597900 GAGTGTATGAAGCAGGAGGAGGG - Intronic
1091791743 12:3275886-3275908 GTGTGCATGAAGAAAAAGGTAGG - Intronic
1092023174 12:5219255-5219277 ATGAAAATGAAAAAAGAGGATGG + Intergenic
1092498160 12:9018747-9018769 TTGTATATCAAGAGAGAGGAGGG - Intergenic
1092516128 12:9215487-9215509 TTGTATAAAAAGAAAGAGAAAGG - Intergenic
1093005950 12:14050952-14050974 GTGTTTAGGATGAAAGAAGATGG - Intergenic
1093373967 12:18400852-18400874 ATATATATAAAGAAAGAGGTAGG - Intronic
1093380245 12:18482640-18482662 GTGAACATGAAGAAAAAGCAAGG - Intronic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1094337065 12:29371645-29371667 GACTATATGAAGGAAGAGGAAGG - Exonic
1094702362 12:32882008-32882030 GGGAATATGCAGAAAGGGGAAGG + Intronic
1095043553 12:37472260-37472282 AAGTAAATGAAGAAAGAGTAGGG + Intergenic
1095259034 12:40077324-40077346 TTGTATATGAAGAAAGGAAAGGG + Intronic
1095260526 12:40093949-40093971 GTGTATAAAAAGAAAGCAGAGGG + Intronic
1095734430 12:45541181-45541203 GGGAATAAGAAGAGAGAGGAGGG - Intergenic
1096188946 12:49602272-49602294 GTGTATTTGAAGACATAGTACGG + Intronic
1096793163 12:54057827-54057849 ATGTATGTGAGGGAAGAGGAAGG - Intergenic
1097368476 12:58746231-58746253 GTGAGTATGAAGTGAGAGGAGGG + Intronic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1097904376 12:64905032-64905054 GTGTGCATGCAGGAAGAGGAGGG - Intergenic
1098191672 12:67955674-67955696 ATGGATATAAAGGAAGAGGAAGG - Intergenic
1098464959 12:70776109-70776131 GTGGATAGGAAGAAGGAGAAAGG - Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1099217479 12:79870784-79870806 GTATATAAGAAGTATGAGGAAGG - Intronic
1099669032 12:85667411-85667433 GTGATTATGAAGAAAGAGATTGG + Intergenic
1099909560 12:88812978-88813000 GTTTATATCAAGAAAAATGAGGG + Intergenic
1100018083 12:90036196-90036218 GTGGATATGATGAAAGAACAAGG + Intergenic
1100214643 12:92434959-92434981 CTGTCTCTAAAGAAAGAGGAAGG - Intergenic
1100216889 12:92459983-92460005 GTGTAGTTGGAGAAAGGGGAAGG - Intergenic
1100337271 12:93642960-93642982 GTGTCTATGAGGATAGGGGAAGG + Intergenic
1101195781 12:102380702-102380724 GTGGATGTGGAGAAAGAGGATGG + Intergenic
1102558372 12:113744210-113744232 GTGTATAGGAAAAAACAGTACGG - Intergenic
1102572737 12:113837150-113837172 GTGTATATTAAGTAGGAGGATGG - Intronic
1104132109 12:125904230-125904252 GTGTATATGGAGGGAGAGAAAGG - Intergenic
1104275860 12:127327196-127327218 GTGTGTAGAAGGAAAGAGGAAGG + Intergenic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104400663 12:128473359-128473381 GTGAAGATGAAGATAGAGGCTGG - Intronic
1104400673 12:128473455-128473477 GTGCAGATGAAGACAGAGGCTGG - Intronic
1104400688 12:128473593-128473615 GTGAAGATGAAGATAGAGGCTGG - Intronic
1104400690 12:128473617-128473639 GTGAAGATGAAGACAGAGGCTGG - Intronic
1105273834 13:18903494-18903516 GGGTAGATGAAGAAAAAGGGTGG - Intergenic
1106043290 13:26114410-26114432 GTGTCTATGGTGACAGAGGATGG + Intergenic
1107020881 13:35749902-35749924 TTGTATATGGTGAAAGAGGGGGG + Intergenic
1107275646 13:38675926-38675948 ATGGATATAAAGGAAGAGGAAGG + Intergenic
1107333973 13:39333728-39333750 GAGGATATGGAGAAATAGGAAGG + Intergenic
1108050706 13:46435214-46435236 GTGGATATGAAGAATCAGGTAGG - Intronic
1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG + Intronic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1109199438 13:59414033-59414055 ATGGATATGAAGAAAGATCACGG + Intergenic
1109242786 13:59910867-59910889 GCGTTTATGAAGAGATAGGAAGG + Intronic
1109487425 13:63045306-63045328 CTGTAAATGAAAAAAGAGAAAGG - Intergenic
1109511025 13:63374330-63374352 GATTAGCTGAAGAAAGAGGATGG - Intergenic
1109543282 13:63808838-63808860 GTGGATATGAAGAATCAGGTAGG - Intergenic
1110486614 13:76051955-76051977 GTGTAGAGGAGAAAAGAGGATGG - Intergenic
1110499557 13:76210886-76210908 GTTTAAATGGAGAAACAGGAAGG - Intergenic
1110534832 13:76639028-76639050 GTGAGTCTGAAGAGAGAGGAAGG - Intergenic
1111482426 13:88848501-88848523 TTGGCTATGAAGAAAAAGGAAGG + Intergenic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1112793219 13:103027381-103027403 GTGCATTTGAAGAAAGAGAGAGG + Intergenic
1113535237 13:111061312-111061334 GTGTTTGTGGAGAAAGAGGGAGG + Intergenic
1113756523 13:112815448-112815470 GTGTGTCTGAAGGATGAGGAAGG - Intronic
1113871850 13:113564679-113564701 GAGCATCTGAAGGAAGAGGAGGG - Intergenic
1114715777 14:24822335-24822357 GTATATGTGAGGCAAGAGGATGG - Intronic
1115013303 14:28577325-28577347 GTGTATCTGAGTATAGAGGAAGG - Intergenic
1115129116 14:30032454-30032476 GTGGAGATGAAGAAAGTGGTTGG - Intronic
1115886354 14:37976070-37976092 TAATATATGAAGAAAGAGCAAGG + Intronic
1115972732 14:38963748-38963770 GTGTATAGAAAGAAACAGCAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1116789284 14:49322551-49322573 GTGTATATATGGAAAGATGAAGG + Intergenic
1117611101 14:57484332-57484354 GTGAAGATGAAGAGAGAGGTTGG + Intronic
1119186510 14:72646641-72646663 GTGTGTTTGAAGGAAGGGGATGG - Intronic
1119813076 14:77540375-77540397 GTGCATATGCAGGAAGAGGAAGG + Intronic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1120754819 14:88232916-88232938 GTGCACATGAACAAATAGGATGG + Intronic
1121906565 14:97751619-97751641 GTGTTTAGGAGGAAAGGGGAGGG - Exonic
1121926837 14:97934712-97934734 CTGACTTTGAAGAAAGAGGAAGG + Intronic
1122074067 14:99224468-99224490 GTGTGAATGAAGGCAGAGGAAGG - Intronic
1122839433 14:104448678-104448700 GTGTTAAAGAAGATAGAGGAAGG + Intergenic
1123163742 14:106306005-106306027 GTGTATGTAAAGACAGAGAAGGG + Intergenic
1202942090 14_KI270725v1_random:159853-159875 AAGTAAATGAAGAAAGAGTAGGG + Intergenic
1124969122 15:34467675-34467697 GTGTAGATGGAGACAGAGGTTGG + Intergenic
1125651984 15:41324790-41324812 GTGAATATGAAGAAAAAAAATGG - Intronic
1126004040 15:44239790-44239812 GTATGTATAAAGAAATAGGAAGG + Intergenic
1126794433 15:52248623-52248645 ATGTATATAAGGAAAGAGTAAGG - Intronic
1128050133 15:64656795-64656817 CTGGATCTAAAGAAAGAGGAAGG - Intronic
1128407866 15:67362061-67362083 GGGAACAGGAAGAAAGAGGAAGG + Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1128651457 15:69417366-69417388 GTATACCTGAAGAAATAGGAAGG - Exonic
1129635000 15:77306203-77306225 AAGTATATTAAGAAAGATGATGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130935004 15:88461923-88461945 GCGTATATGAGAAAAAAGGAAGG + Intronic
1131503313 15:92992130-92992152 GTTTATCAGAAGAAAGAGAAGGG - Intronic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1133353367 16:5117614-5117636 GTGTTTATGCAAAAAGAGGTTGG - Intergenic
1133443285 16:5838291-5838313 GTGTACATGTGGAAAGAGGCAGG - Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136010610 16:27361141-27361163 CTGTATATTAAAAAAAAGGAGGG - Intronic
1140290429 16:73649451-73649473 GTGTATATGCATAAAGAGTTTGG + Intergenic
1140651572 16:77094134-77094156 GTGTACATGAAGAGGAAGGAAGG - Intergenic
1140977911 16:80078267-80078289 CTCTATAGGAAGAAAGTGGAGGG - Intergenic
1141222082 16:82080432-82080454 GTGGCTTTGAAGATAGAGGAAGG + Intronic
1141317306 16:82974723-82974745 CTGTCTTTGAAGATAGAGGAAGG + Intronic
1141604434 16:85144862-85144884 ATGGATTTGGAGAAAGAGGAAGG - Intergenic
1142733490 17:1879416-1879438 GTGTATGAGAAGGAAGAGCAGGG + Intronic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1143980488 17:10865258-10865280 TTGAATGTGAAGGAAGAGGATGG - Intergenic
1144419286 17:15081336-15081358 TTCTTTATGAAGAAAAAGGACGG - Intergenic
1144497744 17:15759272-15759294 GTGTATTTGAAGAAAGAGGGTGG - Intergenic
1144583748 17:16475314-16475336 GTGTGTGTGGAGAGAGAGGAAGG + Intronic
1144629542 17:16863760-16863782 GTGTATTTGAAGAAAGAGGGTGG - Intergenic
1144651887 17:17012357-17012379 GTGTATTGGAAGAAAGAGGGTGG + Intergenic
1145161113 17:20574322-20574344 GTGTATTGGAAGAAAGAGGGTGG - Intergenic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1146551625 17:33785205-33785227 GTGAAGATGAAGAAAGAAGATGG + Intronic
1148445975 17:47737428-47737450 GTGCATGTGAAGACAGAGGTTGG + Intronic
1149173950 17:53846771-53846793 CTGGCTTTGAAGAAAGAGGAAGG - Intergenic
1149240633 17:54644712-54644734 GAGGATGTGAAGAAATAGGAAGG + Intergenic
1149507822 17:57210677-57210699 GTGTAAAAGAAAAAAGAGGTGGG + Intergenic
1150509480 17:65735039-65735061 GTGAATGGGAAGAAAGGGGAAGG - Intronic
1150563831 17:66320038-66320060 ATGTATATGAATTAAGAGGCAGG - Intronic
1150977233 17:70102184-70102206 GTGAACAAGAAGAAAGAAGAAGG - Intronic
1151776500 17:76207056-76207078 GTGTATATACAGAAAGATGGTGG - Intronic
1153400330 18:4678214-4678236 GTTCATATGAAGAAAGAAAAGGG + Intergenic
1153699046 18:7674103-7674125 GTGAATGTGAGGAAAGAGAAGGG + Intronic
1154465541 18:14640734-14640756 GGGTAGATGAAGAAAAAGGGTGG - Intergenic
1155015838 18:21838408-21838430 GTGGATGAGAAGAAAGATGATGG + Exonic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1155851523 18:30780786-30780808 ATGTGGATGAAGAAAGAGCAGGG + Intergenic
1156284402 18:35676651-35676673 GAATAAAGGAAGAAAGAGGAGGG + Intronic
1157049632 18:44147168-44147190 AAGTAGATGAAGAAAAAGGAAGG + Intergenic
1157149746 18:45204918-45204940 GTTTGTATGAAGAAAGAGGGAGG + Intergenic
1158403418 18:57140911-57140933 GTGTCAGTGAAGAAGGAGGAAGG + Intergenic
1158496852 18:57963493-57963515 GTGTATATGAAGCAAGGTCAGGG + Intergenic
1158520114 18:58164903-58164925 GTGTCTATGAAGCAATTGGATGG - Intronic
1158617515 18:59001765-59001787 ATAAGTATGAAGAAAGAGGAAGG - Intergenic
1159145342 18:64447001-64447023 AAGTATTTGAAGAAAAAGGAAGG + Intergenic
1159528225 18:69621495-69621517 ATGTATATGAGGAAACAAGAGGG + Intronic
1159827584 18:73233475-73233497 GTGTATATGAGCAAACAGGTGGG + Intronic
1159926421 18:74273632-74273654 GAGTATATTTAGAAAGAGGCAGG - Intronic
1161358775 19:3834469-3834491 GTGACTATGAAGGAGGAGGAGGG - Intronic
1164265501 19:23612478-23612500 TTATATATGAAGTAAGATGAGGG + Intronic
1164375288 19:27678737-27678759 GTGTCTATGTAGAAAGAAGAAGG - Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1165424009 19:35735833-35735855 GTGGATGTGAAGAAGGGGGATGG - Intronic
1165817987 19:38654747-38654769 TTGTTTATGGAGAAAGGGGAGGG - Intronic
1166153049 19:40888493-40888515 GTGGAGATGAACAAAGAGAAAGG - Intronic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
925363325 2:3294769-3294791 GTGTGTATGTAGAGAGAGGATGG - Intronic
925363388 2:3295082-3295104 GTGTATGTGTGGAAAGAGGATGG - Intronic
925363413 2:3295220-3295242 GTGTATGTGTGGAGAGAGGACGG - Intronic
925363524 2:3295754-3295776 GTGTGTGTGCAGAGAGAGGACGG - Intronic
925363568 2:3295960-3295982 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363587 2:3296060-3296082 GTGTGTGTGCAGAGAGAGGAGGG - Intronic
925363655 2:3296375-3296397 GTGTGTGTGCAGAGAGAGGATGG - Intronic
926646503 2:15295240-15295262 GTGTATAGCAAGAATGAGCATGG + Intronic
927037232 2:19190756-19190778 GTGTTAATGAAGAAAAAGAAAGG - Intergenic
927056035 2:19366242-19366264 TTGCATATGTGGAAAGAGGAGGG + Intergenic
927955679 2:27205846-27205868 TGGTATATGAAGGTAGAGGATGG - Intronic
929083386 2:38144274-38144296 ATGTATATGGGGAATGAGGAAGG - Intergenic
929331074 2:40681755-40681777 GGGGATGTGAAGAAATAGGAAGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929742514 2:44618030-44618052 GTGTATACAAAGAAACAGGAAGG - Intronic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
930292156 2:49508680-49508702 GTGAAGATGAAGGAAGAGCAAGG - Intergenic
930630187 2:53745206-53745228 GTGTATATGGAGCAAGGGGAAGG + Intronic
931591815 2:63892472-63892494 GTGTATACGAACAAAGACCAGGG - Intronic
931617418 2:64174067-64174089 GTGTTTATGAAGTAAGACAAAGG + Intergenic
932957287 2:76367469-76367491 GTGTATGTGATAAAAAAGGATGG - Intergenic
933409886 2:81911744-81911766 GAGGAAAGGAAGAAAGAGGAGGG - Intergenic
933584030 2:84160686-84160708 GTGTATCTAAAGAAAGAGGCAGG + Intergenic
934314736 2:91906842-91906864 GAGGATATGGAGAAATAGGAAGG + Intergenic
936114446 2:109690846-109690868 GTGTACATGAAGGAAGAAGGTGG - Intergenic
937467586 2:122148241-122148263 TAGTAAATGAAGAAAGAAGAAGG + Intergenic
938600903 2:132838066-132838088 GTGAATAAGTTGAAAGAGGAGGG - Intronic
938639178 2:133262588-133262610 GTTTATTAGGAGAAAGAGGATGG + Intronic
938749443 2:134314682-134314704 TTTTAGCTGAAGAAAGAGGAAGG + Intronic
939589456 2:144045776-144045798 GTGTGCAGGAAGAGAGAGGAAGG + Intronic
940801233 2:158135540-158135562 GTGATTCTGAAGAAAAAGGAAGG - Exonic
940817583 2:158312814-158312836 GTGAAGAGGATGAAAGAGGATGG + Intronic
940989074 2:160079727-160079749 GTGAATATGAAGACAGAGGTTGG + Intergenic
941399804 2:165016735-165016757 ATGTATATTTAGAAAGAGGAAGG - Intergenic
941656154 2:168146820-168146842 CTGTATATGAATAGAGAGGTTGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942119953 2:172766680-172766702 GTGTTGATGAAGAAAGGCGACGG - Intronic
942168377 2:173264861-173264883 GGGGAAATGGAGAAAGAGGAAGG + Intronic
942668003 2:178342708-178342730 TTTTAAATGAAGTAAGAGGAAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
943750895 2:191508457-191508479 GTGTTTGTGGAGAAAGAGGGAGG + Intergenic
945441391 2:209884316-209884338 GTCTATAATAATAAAGAGGAAGG + Intronic
945761050 2:213915749-213915771 GAGGATGTGAAGAAATAGGAAGG - Intronic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
946973693 2:225123427-225123449 GAGGAAATGAAGAAAGAGAAAGG - Intergenic
947019146 2:225655072-225655094 TGGTATATGAACAAAGGGGAAGG + Intergenic
948768958 2:240237679-240237701 GTGTAAATGCAGTAAGAGGCAGG - Intergenic
1169151701 20:3294661-3294683 GTGTATATGCTGAAGGAAGATGG - Intronic
1169958019 20:11127372-11127394 GTGGATAAGAAGTAAGAGAAGGG - Intergenic
1170225559 20:13988143-13988165 GTGTATATGAGGTATGAGGTGGG + Intronic
1170530077 20:17282220-17282242 GTGTGTATGGAGAGAGAGGTAGG - Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171119930 20:22559270-22559292 GGGTATATGAGGAAGGAGTATGG - Intergenic
1172083128 20:32358316-32358338 GTGTGTGTGAAGAGTGAGGAGGG - Intergenic
1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG + Intergenic
1172570179 20:35964157-35964179 AGATATATGAAGAAAGAGCAGGG - Intronic
1172898490 20:38316996-38317018 GGGGATAGGAAGAAAGTGGAAGG + Intronic
1173016126 20:39227442-39227464 GTGTATCTGAAGAGGGAGGCAGG - Intergenic
1173871450 20:46344566-46344588 GTGCACATGGGGAAAGAGGAGGG - Intergenic
1175069481 20:56320674-56320696 TTGTATATGATGAGAGATGAGGG - Intergenic
1175159471 20:56997134-56997156 ATGAAGCTGAAGAAAGAGGAAGG + Intergenic
1176317358 21:5259048-5259070 GTCTATTTGAAGTAAGAGGGTGG - Intergenic
1176581080 21:8527077-8527099 AAGTAAATGAAGAAAGAGTAGGG - Intergenic
1177788696 21:25698488-25698510 GTGCCCATGAAGAAAGAAGATGG + Intronic
1178115526 21:29412617-29412639 GTTTATATGAACATAGAGGCTGG - Intronic
1178229235 21:30762050-30762072 TTGGACATGATGAAAGAGGAAGG - Intergenic
1179270020 21:39843669-39843691 GTGTAGGGGAAGGAAGAGGAAGG + Intergenic
1180592139 22:16949393-16949415 GTAAGTATGAACAAAGAGGAGGG + Intergenic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1182990068 22:34759182-34759204 ATGGATAGGAAGAAAGTGGAAGG + Intergenic
1183318785 22:37151733-37151755 TTGTATATGAAGAGAGATGAGGG + Intronic
1184617982 22:45651021-45651043 GTGTGAATGAACAAAGAGAATGG - Intergenic
949759425 3:7453081-7453103 GGGTATAGGATGGAAGAGGAAGG + Intronic
949824522 3:8151500-8151522 GTATATAACAAGAAGGAGGAAGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950832084 3:15885040-15885062 GTGGGAAGGAAGAAAGAGGAAGG + Intergenic
950918536 3:16669496-16669518 GTCTATATGGAAAAAGAGGAAGG - Intronic
951028487 3:17854968-17854990 TTGTATATGATGAAAGAGAGGGG + Intronic
951137793 3:19124093-19124115 GTGCATCTGAAGAGAGAGCAAGG + Intergenic
953199450 3:40765863-40765885 GTCTAAATGAAGAAAAAGAAAGG + Intergenic
953554726 3:43935065-43935087 GAGGATATGGAGAAATAGGAAGG - Intergenic
954092922 3:48299931-48299953 GTGGATATGAAGAGTGAGGGAGG - Intronic
954533141 3:51338042-51338064 GGGTATATGAATTAAGTGGAAGG - Intronic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
957774579 3:84739949-84739971 ATGTATTTGAAGACAGAGCAAGG - Intergenic
958013390 3:87910092-87910114 ATGTATATGAAGAATAAGAAGGG - Intergenic
958842909 3:99230274-99230296 GTGTATTTGAGGACAGAGGGTGG - Intergenic
958915185 3:100041973-100041995 ATATAGCTGAAGAAAGAGGAAGG - Intronic
959007842 3:101040526-101040548 GTGTATCTGAGGAATGAGGAGGG - Intergenic
959257531 3:104033529-104033551 GTTTTTTTGAAGAAAGCGGAAGG - Intergenic
959561094 3:107782386-107782408 GTGTATATATATAAAGAGCAAGG - Intronic
959872578 3:111345379-111345401 GGCTATTTGAAGAAAGTGGAGGG + Intronic
959895894 3:111605530-111605552 GGATGTATGAAGAAAAAGGATGG + Intronic
960357751 3:116674360-116674382 GTGTACATGCAGAAGGAGGTGGG - Intronic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
961296125 3:125886112-125886134 GTGTTTATGCAAAAAGAGGTTGG + Intergenic
961889674 3:130120062-130120084 GTGTTTATGTAAAAAGAGGTTGG - Intergenic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
962035890 3:131651184-131651206 ATGTATGGGAAGAAAGGGGAAGG - Intronic
962502688 3:136011026-136011048 TGGTATATTTAGAAAGAGGAGGG - Intronic
962898245 3:139735233-139735255 GTTTATTTGAATGAAGAGGAAGG - Intergenic
962911435 3:139855121-139855143 GAGGATAGGAAGAAAGAGAAAGG - Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963686981 3:148448157-148448179 GTGTATGTGAAGGCAGAAGAGGG + Intergenic
963941413 3:151099221-151099243 GAATATGTGAAGTAAGAGGAAGG + Intronic
964003496 3:151805305-151805327 GAGAATATCAGGAAAGAGGATGG + Intergenic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
965342747 3:167510823-167510845 GTGCACAGGAAGAAAGATGAAGG - Intronic
965945482 3:174235254-174235276 GTGTATATGAAGGAGGGGTAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967630084 3:191735579-191735601 GTGGATGTGGAGAAATAGGAAGG + Intergenic
968144815 3:196289123-196289145 GTGGCTGAGAAGAAAGAGGATGG + Intronic
968341262 3:197957877-197957899 GTGTAGAGGAAGAAATAGGGCGG + Intronic
968712292 4:2127591-2127613 GAGAATATGATGAAAAAGGACGG + Intronic
969753862 4:9134627-9134649 GTGTTTATGCAAAAAGAGGTTGG + Intergenic
970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG + Intergenic
970120124 4:12744245-12744267 GTGGATGTGAAGAAAGAGGTGGG + Intergenic
971688771 4:29805312-29805334 GTGTAAGATAAGAAAGAGGAAGG - Intergenic
972002113 4:34050598-34050620 ATGTATATAAAGGAAGAGCAAGG + Intergenic
973038043 4:45432370-45432392 GTTTATATGAAGAGGGAGCATGG - Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973335345 4:48950210-48950232 GGCTATAGGAGGAAAGAGGAGGG + Intergenic
973936787 4:55854141-55854163 GTGAATTTGGACAAAGAGGAAGG - Intronic
974389261 4:61244181-61244203 GTAAATATGATGAAAGGGGAGGG + Intronic
974771048 4:66414084-66414106 GGGGACATGAAGAAATAGGAAGG + Intergenic
975289147 4:72656643-72656665 GAGGATATGGAGAAATAGGAAGG + Intergenic
978257229 4:106707377-106707399 GAGTATGGGAAGAAACAGGAAGG + Intergenic
979403435 4:120280097-120280119 ATGTATATAAAGAAAAAGTATGG + Intergenic
979600290 4:122580191-122580213 TGGCAGATGAAGAAAGAGGAAGG + Intergenic
979687252 4:123524506-123524528 GAGGAAAGGAAGAAAGAGGAAGG - Intergenic
979962862 4:127041856-127041878 TTGTATATGATGAAAGATAAGGG - Intergenic
980311850 4:131141504-131141526 GTGTATATGATGTAAGATAAGGG - Intergenic
981016847 4:139982641-139982663 GTGTATAGGAAAAAAGTGTATGG - Intronic
981321354 4:143395839-143395861 GAGTAAGTGAAGAAAGAAGAAGG + Intronic
981498445 4:145419712-145419734 GCAGATATGAACAAAGAGGAGGG + Intergenic
981731827 4:147907630-147907652 GTGTATAGGAAAAGAGAGCAAGG + Intronic
982323686 4:154107603-154107625 GTGTATATGAGTTAAGTGGATGG + Intergenic
982558289 4:156897445-156897467 GTGTATGTGTAGAGAGAGGGAGG - Intronic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
983860577 4:172700864-172700886 GTGTATCTATGGAAAGAGGAGGG + Intronic
983891623 4:173035553-173035575 GTGTGTATGAGGAGAGAGCATGG - Intronic
984154842 4:176183428-176183450 ATGTAAATGAAGATACAGGATGG - Intergenic
986856856 5:11879157-11879179 GTGTCTATGAAAGGAGAGGAAGG + Intronic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
987642559 5:20631501-20631523 TTGTATCTGAAAAAAAAGGAAGG + Intergenic
987685405 5:21193147-21193169 GTGTATAGACAGAAAGAGGTTGG - Intergenic
988011882 5:25499125-25499147 GTGTGTATGAAGAATGAGACTGG + Intergenic
988628885 5:32907758-32907780 GAGGATATGGAGAAACAGGAAGG - Intergenic
989177638 5:38544337-38544359 GTGTATGTGAAGAGTGTGGAAGG - Intronic
989392823 5:40920350-40920372 GTGGATCTGAAGAAAGAGATGGG + Intronic
989480645 5:41925976-41925998 GTGTATTTGAAGAAACAAAACGG + Intronic
990659921 5:58001938-58001960 GTGAATTTCAAAAAAGAGGAGGG - Intergenic
990748894 5:58990384-58990406 ATGGATATGAAGAAAGAAGCAGG + Intronic
990853576 5:60236755-60236777 CTGGATTTGAAGACAGAGGAAGG + Intronic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
992363241 5:76064267-76064289 GTTTCTTTGAAGAAAGAGAATGG - Intergenic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
993316068 5:86407922-86407944 GTGTACATGCAGAGACAGGAAGG + Intergenic
993548323 5:89241308-89241330 GTGTATGTTAAGAGAGGGGAAGG - Intergenic
993644453 5:90445399-90445421 GAGCATCTGAAGAAAGAAGAAGG - Intergenic
993760732 5:91793572-91793594 GTGTATATATAGAGAGAGGGGGG - Intergenic
994335326 5:98558257-98558279 CTGTATAGGAATGAAGAGGAGGG + Intergenic
994345891 5:98685751-98685773 GAGGATGTGAAGAAATAGGAAGG + Intergenic
996672253 5:126132327-126132349 GAGTAAAACAAGAAAGAGGAGGG + Intergenic
996983601 5:129531707-129531729 ATGTATATGAACAAATTGGATGG + Intronic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998499683 5:142621523-142621545 GTGAATTTTAAGAAAGAGTAGGG - Intronic
998708088 5:144787953-144787975 GTGTTCATGAAGAAAGAAGATGG + Intergenic
1000134413 5:158332516-158332538 TTGTATATGGTGAAAGAAGAGGG + Intergenic
1000161388 5:158600954-158600976 TTGTGTATGAAGACAGAGGCTGG - Intergenic
1000232663 5:159330637-159330659 GTGTGTATCAATAACGAGGAGGG + Exonic
1000463649 5:161549458-161549480 GTGTATAGGAGTAAAGAGAAAGG - Intronic
1001222454 5:169913395-169913417 GTGTTTTTGGAGAAAGAGGAGGG - Intronic
1001831059 5:174789795-174789817 GTGTATAGGAGGAATGAGAATGG + Intergenic
1002606079 5:180383527-180383549 GTGTCTAGATAGAAAGAGGAAGG + Intergenic
1003825928 6:9951981-9952003 GTGAATATGAAGAAAGAGATGGG + Intronic
1003901248 6:10657808-10657830 GTCTAAATGAAGCAAGAGCAGGG - Intergenic
1004153780 6:13148570-13148592 GTATATGTGAAAAAAAAGGAAGG - Intronic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004407143 6:15343601-15343623 GTGTATTTGGAGGGAGAGGAAGG + Intronic
1004604795 6:17183913-17183935 GTGTAAATGAAGGAAGCGGCAGG - Intergenic
1005080886 6:21955320-21955342 CAGTATGTGAAGGAAGAGGAAGG + Intergenic
1005959204 6:30684255-30684277 GTGTATGTGCAGAGCGAGGAAGG + Intronic
1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG + Exonic
1007291315 6:40789137-40789159 GTGTGTGTAAAGAAAGAGAAAGG - Intergenic
1007372777 6:41437592-41437614 TTGGCTATGAAGAAAGATGATGG + Intergenic
1008405870 6:51117946-51117968 GTAAATATGAAGTAAGAGGTGGG - Intergenic
1009212892 6:60884219-60884241 GAGGATATGGAGAAATAGGAAGG - Intergenic
1010048175 6:71471572-71471594 GTGTATAAGAAGAAATGGGCTGG - Intergenic
1010751610 6:79621746-79621768 GTGTATATCAAGAAGGAGAATGG - Intergenic
1011534655 6:88363180-88363202 AAGCATATCAAGAAAGAGGAAGG - Intergenic
1012042581 6:94228061-94228083 GGGTTAATGAAGAAAGAGTAAGG - Intergenic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1012117078 6:95314625-95314647 GTGTACATGAACATAGAGCATGG + Intergenic
1012242484 6:96889380-96889402 GTAGATATGAATAAAGAAGATGG + Exonic
1012289691 6:97437480-97437502 GTGTGCATGATGAAGGAGGAAGG - Intergenic
1012950219 6:105510224-105510246 GGGTTTATGCAGAAAGAAGAGGG + Intergenic
1013150279 6:107439123-107439145 CTGTACAGGAAGAAAGTGGAGGG - Intronic
1013972687 6:116039805-116039827 GGGTGTAAGAAGGAAGAGGATGG - Intronic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1015156357 6:130100913-130100935 CTGTATATGAAGAAAGTGACAGG - Intronic
1015506777 6:133996719-133996741 GTGAACTTGAAGAATGAGGAAGG - Intronic
1015712269 6:136155248-136155270 GTGTAAATGAAGAAAAAAGTTGG - Intronic
1016159970 6:140867410-140867432 ATATATATGAAGAAATAGGCAGG + Intergenic
1016702336 6:147067635-147067657 GGGTATTTGAAGAGAGTGGAAGG + Intergenic
1016754396 6:147667772-147667794 CTGTTTGTGAAGAAAGAGAATGG - Intronic
1017565821 6:155685491-155685513 GGGTATATAAAGAAAGACAATGG + Intergenic
1017582757 6:155884530-155884552 GTGTATAAGGAGAAAGATGGTGG - Intergenic
1018634753 6:165851015-165851037 GTGTATAGGAAGAGAAAGGAAGG + Intronic
1018683249 6:166282143-166282165 ATGGAGCTGAAGAAAGAGGAGGG + Intergenic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1021763261 7:23921862-23921884 GTGGATAGGGAGAAAGTGGAGGG + Intergenic
1022819712 7:33947339-33947361 CTCTATATGAGGAAAGAAGATGG - Intronic
1023281540 7:38575785-38575807 GTGGAGATGAACAAAGTGGAAGG - Intronic
1023503638 7:40876981-40877003 GTGTATATTAAAGAAGAGAAAGG - Intergenic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1024663903 7:51526857-51526879 GAGGATATGGAGAAAGGGGAAGG + Intergenic
1025289461 7:57701820-57701842 AAGTAAATGAAGAAAGAGTAGGG + Intergenic
1028330329 7:89582961-89582983 ATGTCTTTGAAGAAAGAAGACGG - Intergenic
1028591103 7:92496261-92496283 CTGTATATGAATACAGAAGATGG - Intronic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1029556191 7:101270983-101271005 ATTTATCTGAAGAAAGAGAAAGG + Intergenic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029962318 7:104700987-104701009 GTGTAAACAAAGAAAGATGAAGG - Intronic
1030031853 7:105376964-105376986 GTGAATAGGAAGATAGAGCAGGG - Intronic
1030462029 7:109850747-109850769 GGGTATATGAAGAAATAAGGAGG + Intergenic
1030462903 7:109863005-109863027 GAGTATGTGGAGAAATAGGAAGG + Intergenic
1031119951 7:117710430-117710452 GTATTTATGAAAAAAAAGGAAGG + Intronic
1031744936 7:125483636-125483658 GTGTGTAAGAAGACAGAGGAGGG + Intergenic
1032156756 7:129475955-129475977 GTGTCTGTGTAGAAAGAGGCGGG - Intronic
1033724635 7:144101404-144101426 GAGTAAATCAAAAAAGAGGATGG - Intergenic
1033919640 7:146374025-146374047 GTGTCAACCAAGAAAGAGGAAGG + Intronic
1033932318 7:146539280-146539302 GGGTTTCTGAAGAATGAGGAAGG + Intronic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1035894906 8:3388861-3388883 GTGTGTATGTAGAGAGAGGGAGG - Intronic
1035976520 8:4318338-4318360 GTGCATAAAAAGAGAGAGGAGGG - Intronic
1037338586 8:17816467-17816489 GAGGATATGGAGAAATAGGAAGG + Intergenic
1038052964 8:23830741-23830763 GCATATAAGAAGAAAGAGGGTGG + Intergenic
1038548539 8:28444925-28444947 GTGAAAATGAAGAAATAGGCCGG - Intronic
1039201592 8:35099994-35100016 GTCAAAATGAAGGAAGAGGAGGG - Intergenic
1039575067 8:38616514-38616536 GTGTAGCTGAAGACAGAGCAAGG - Intergenic
1039674911 8:39651706-39651728 GTGTCTATGTAGAAAGAAGTAGG - Intronic
1041428445 8:57750116-57750138 GTGTAAATAAATAATGAGGAAGG + Intergenic
1041754679 8:61300916-61300938 GTTTATAAGAAGAAAGTGGTAGG - Intronic
1041978652 8:63829525-63829547 CTGGATATGAGCAAAGAGGAGGG - Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042160350 8:65887728-65887750 GTGTACATTAAGAAAGATGGAGG + Intergenic
1042629061 8:70796250-70796272 GTACATATGAACAAAGAGAAGGG - Intergenic
1042998094 8:74723267-74723289 GTGTATTTGAAGAAGAATGATGG - Intronic
1043487870 8:80716192-80716214 GTGTCTATGATGAAGGATGAAGG - Intronic
1043648421 8:82554359-82554381 GTTTAAATGAAGTAAGAGAATGG - Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044301275 8:90586423-90586445 GGGTGTAGGATGAAAGAGGATGG - Intergenic
1044437916 8:92187846-92187868 GTGTATGAAAAAAAAGAGGAGGG - Intergenic
1045783189 8:105891871-105891893 GAAGATATGAAGAAAGAGGGAGG + Intergenic
1045855049 8:106755381-106755403 GTGTACAGGAGGAGAGAGGATGG - Intergenic
1046586772 8:116157354-116157376 GTGGCTATGAACAAAGAGGCAGG + Intergenic
1046676146 8:117110856-117110878 CTGTAAAGCAAGAAAGAGGATGG - Intronic
1047290311 8:123524150-123524172 GGGTATTTGAAGAAGTAGGAGGG - Intronic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1050288159 9:4125650-4125672 GTGTGTATTCAGAAAGAGAACGG + Intronic
1051392240 9:16578159-16578181 GTGTATTTGATAAAAGAGGTGGG - Intronic
1052509682 9:29399835-29399857 GAATACAGGAAGAAAGAGGAAGG - Intergenic
1052539239 9:29786710-29786732 TTGTATATGATGAAAGACAAGGG - Intergenic
1056422892 9:86446874-86446896 GTGTGTATGAAGGAGAAGGATGG + Intergenic
1059048800 9:110900276-110900298 TTGGCTTTGAAGAAAGAGGAAGG - Intronic
1059061766 9:111040336-111040358 GTGTATAGGAAGAAAGAGACGGG - Intergenic
1059577671 9:115508108-115508130 GTGTAAGAGAAGAAAGAGAAAGG + Intergenic
1059672028 9:116501025-116501047 GTGTATATTTAGAAAAGGGAGGG - Intronic
1059687648 9:116652792-116652814 GTGCACATGAAGAAAGAGGCAGG - Intronic
1059741693 9:117157237-117157259 CTGTATTTGAACACAGAGGAGGG + Intronic
1060874274 9:127069055-127069077 GTGCATATGAAGAAGGAGGCAGG - Intronic
1203415622 Un_KI270582v1:4096-4118 GTCTATTTGAAGTAAGAGGGTGG - Intergenic
1203611094 Un_KI270749v1:5120-5142 AAGTAAATGAAGAAAGAGTAGGG - Intergenic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1186333132 X:8557687-8557709 GAGGATATGGAGAAATAGGAAGG + Intronic
1186938441 X:14476896-14476918 TTGGCTGTGAAGAAAGAGGAAGG + Intergenic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1188489503 X:30722771-30722793 GTGTGTGTGAAGAGAGAGGGGGG + Intronic
1188888301 X:35577974-35577996 GTGTATATGGTGAAAGAGAAGGG - Intergenic
1189212711 X:39298222-39298244 GTGTATGTAGTGAAAGAGGATGG + Intergenic
1189985165 X:46546864-46546886 GTGTTTATGCAGAAAGAGAAGGG + Intergenic
1190473460 X:50805716-50805738 GGGTATGAGAAGAAACAGGAGGG + Intronic
1190798322 X:53764612-53764634 GTGAAGATAAAGAAAGAGAATGG - Intergenic
1192218786 X:69182591-69182613 GTGTTTAGGAAGAAATAGGAGGG + Intergenic
1192315196 X:70045796-70045818 GAGTAAACCAAGAAAGAGGAAGG + Intronic
1192890979 X:75390122-75390144 GTGTATTTGTGGAAAGGGGAGGG + Intronic
1193731656 X:85109630-85109652 GTGTAAGTGAAAAATGAGGACGG - Intergenic
1194645148 X:96450302-96450324 GAATATATGAAGAAATGGGATGG + Intergenic
1194751505 X:97689813-97689835 GTGTAAACCAAGAAAGCGGAAGG + Intergenic
1195348901 X:103978544-103978566 AATTATAGGAAGAAAGAGGAAGG + Intergenic
1195358542 X:104060295-104060317 AATTATAGGAAGAAAGAGGAAGG - Intergenic
1195625345 X:107000361-107000383 GCGTGAATGAAGCAAGAGGAGGG + Intergenic
1196308210 X:114128844-114128866 GTGTAAATAAAGACAGAGAAAGG - Intergenic
1196557243 X:117102199-117102221 TTGTATATGGTGAAAGATGAGGG + Intergenic
1197121250 X:122895659-122895681 GTCTATATAAGGAAAGAGGGAGG - Intergenic
1198109544 X:133490839-133490861 TTGTATATGATGAAAGATAAGGG + Intergenic
1198391806 X:136182798-136182820 ATGTATAAGAACAAAGAGGCTGG + Intronic
1198542317 X:137652916-137652938 GTGTGTGTGTAGGAAGAGGAGGG + Intergenic
1198873893 X:141202889-141202911 CTGTATAGGTAGAAAGATGAGGG - Intergenic
1199030793 X:142996814-142996836 ATGTCTATAAAGATAGAGGAGGG + Intergenic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1199902961 X:152195615-152195637 TCGGATTTGAAGAAAGAGGAAGG - Intronic
1199912856 X:152306847-152306869 GTGTATATCAACTTAGAGGAGGG - Intronic
1200052413 X:153441992-153442014 GTGTATATAGAGAAAGAGACAGG + Intergenic
1202332914 Y:23773507-23773529 GTGTATATCTAGTAATAGGATGG + Intergenic
1202537855 Y:25896556-25896578 GTGTATATCTAGTAATAGGATGG - Intergenic