ID: 1128649067

View in Genome Browser
Species Human (GRCh38)
Location 15:69397285-69397307
Sequence GTCACTTCCATTGGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128649061_1128649067 6 Left 1128649061 15:69397256-69397278 CCTGGAGATCTTTTTGCATCTGA 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1128649067 15:69397285-69397307 GTCACTTCCATTGGGGTGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 172
1128649058_1128649067 27 Left 1128649058 15:69397235-69397257 CCATGGTCAGGAGATGGTGTCCC 0: 1
1: 0
2: 1
3: 7
4: 179
Right 1128649067 15:69397285-69397307 GTCACTTCCATTGGGGTGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 172
1128649060_1128649067 7 Left 1128649060 15:69397255-69397277 CCCTGGAGATCTTTTTGCATCTG 0: 1
1: 0
2: 1
3: 25
4: 238
Right 1128649067 15:69397285-69397307 GTCACTTCCATTGGGGTGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 172
1128649057_1128649067 28 Left 1128649057 15:69397234-69397256 CCCATGGTCAGGAGATGGTGTCC 0: 1
1: 0
2: 0
3: 22
4: 446
Right 1128649067 15:69397285-69397307 GTCACTTCCATTGGGGTGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128649067 Original CRISPR GTCACTTCCATTGGGGTGGG AGG Intronic
900747231 1:4368818-4368840 GTGAGTTGCATGGGGGTGGGGGG + Intergenic
901173204 1:7279268-7279290 GGCACATCCACTGGGGTGGGAGG + Intronic
901412348 1:9093213-9093235 GTCCCTTCCATTTAGGTGTGAGG - Intergenic
902184004 1:14711517-14711539 GTCCCTTCCTTTGGGTGGGGTGG + Intronic
902252116 1:15160859-15160881 ATCAGCTCCATCGGGGTGGGGGG - Intronic
903110580 1:21129720-21129742 CTCACTGGAATTGGGGTGGGGGG - Intronic
904245669 1:29186124-29186146 GCCACTTGCATTGGGGAAGGAGG - Intergenic
907182289 1:52581423-52581445 GTCACTTCCAGTGGGGTTGTGGG - Intergenic
907470233 1:54668957-54668979 GTCTGTGGCATTGGGGTGGGAGG + Intronic
908256967 1:62310787-62310809 GTTCTTTCCATTTGGGTGGGAGG - Intronic
909200116 1:72680544-72680566 TTCATCTCCTTTGGGGTGGGGGG + Intergenic
910745355 1:90568595-90568617 GTCACATCTCTTGGGGTGGTGGG - Intergenic
916423549 1:164659608-164659630 GACACCTCCATTGGCTTGGGTGG + Intronic
916528521 1:165633641-165633663 GTTCCTTCCTTTGGGGTGGTTGG + Intronic
916760519 1:167812224-167812246 GTCACTTCAACTGGAGTGGGAGG - Intronic
1063233519 10:4089051-4089073 ATCAGTTCCACTAGGGTGGGGGG + Intergenic
1066659709 10:37727855-37727877 GGCACTGCCTGTGGGGTGGGGGG + Intergenic
1067346616 10:45442816-45442838 GTCCCTTGCATTGGATTGGGCGG + Intronic
1067830460 10:49608874-49608896 GGCACTTCCTGCGGGGTGGGGGG + Intergenic
1071997381 10:91162286-91162308 GTCACTTCTGGTGGGGTGGCGGG + Intergenic
1074215490 10:111380099-111380121 TTCTGTTCCATGGGGGTGGGGGG - Intergenic
1074351670 10:112743696-112743718 GACTATTCCACTGGGGTGGGAGG - Intronic
1074436122 10:113436033-113436055 GTCACTTCTTTGGGGGTGGAGGG - Intergenic
1075461234 10:122617776-122617798 GTCACTTCCAGTGGGGTCACAGG + Intronic
1076121654 10:127941179-127941201 GTCACTGCCACTGGGCTGGCAGG + Intronic
1077194364 11:1272039-1272061 AGCACTTCCAGTGGGGTGCGGGG + Intergenic
1077433761 11:2528456-2528478 GTCCCTTCCATTGGCCTGAGCGG + Intronic
1079095763 11:17509348-17509370 GACATTACCTTTGGGGTGGGTGG + Exonic
1081470801 11:43368703-43368725 GTCACTCCCTTTGGGATAGGAGG + Intronic
1081618000 11:44601755-44601777 GTCAGGTCCCTTGGGGTGGGTGG - Intronic
1084541527 11:69789844-69789866 CTCACCTAAATTGGGGTGGGCGG + Intergenic
1084743941 11:71155709-71155731 GTCACTCTACTTGGGGTGGGTGG - Intronic
1085517585 11:77120622-77120644 GTCCCTTCCATGGTGGTGAGGGG + Intronic
1088335605 11:108700133-108700155 ATCACTTTTATTGGGGTGGAGGG + Intronic
1092218586 12:6698560-6698582 GGCACTGCCAGAGGGGTGGGAGG - Intronic
1092219442 12:6702774-6702796 GGCACTGCCAGAGGGGTGGGAGG - Intergenic
1093619309 12:21267819-21267841 GCCACTTCCTTTGTGGTGGGAGG - Exonic
1096596223 12:52697472-52697494 GTCAATTGCATTGGGTGGGGAGG - Intronic
1098228508 12:68349214-68349236 GTCACTTTCAGCGGGGTTGGAGG - Intergenic
1100411980 12:94328224-94328246 CTCTCTTCAATGGGGGTGGGGGG + Intronic
1101471476 12:105000673-105000695 GTCCCTTCCATAGGGGTTTGAGG + Intronic
1101553788 12:105787666-105787688 GTCAATCTCATTGGGGTTGGTGG - Intergenic
1101758475 12:107639961-107639983 ACCACTTCCATTGGGCAGGGAGG + Intronic
1102923647 12:116810809-116810831 TTTGCTTCCATTGGGGTAGGGGG + Intronic
1103132668 12:118482641-118482663 GTCCCTTCCATTTAGGTGTGAGG + Intergenic
1104920775 12:132289597-132289619 GTCACTTGCATGGGGGTTAGGGG + Intronic
1105851385 13:24339427-24339449 GTCACTTTCTTGGGGGGGGGTGG + Intergenic
1108756538 13:53509919-53509941 GTTTATTCCATTTGGGTGGGTGG + Intergenic
1110306920 13:73999232-73999254 ATCACTTCAATTAGGGTAGGTGG + Intronic
1112569607 13:100581861-100581883 GTCACTGCCACAGGGGTGTGGGG - Intronic
1113128261 13:107005141-107005163 GTCACTTAAATTGGTGTTGGAGG + Intergenic
1113791944 13:113033637-113033659 GCCAACTCCGTTGGGGTGGGGGG - Intronic
1118713352 14:68540610-68540632 GTGACTTTCTTTGGGTTGGGGGG - Intronic
1119171621 14:72540182-72540204 GTTGTTTCCTTTGGGGTGGGAGG + Intronic
1119859492 14:77925947-77925969 GTCACTGCCACTGAGGTAGGGGG + Exonic
1121616892 14:95319572-95319594 GTCACTTGCCTCGAGGTGGGAGG - Intronic
1122862165 14:104587591-104587613 GTCACTTCCTGTAGGGTGAGGGG - Intronic
1127216091 15:56824395-56824417 GTCACTTCTTTTTGGCTGGGTGG - Intronic
1127838495 15:62809932-62809954 GTCACTGACATCGGGGTGGAAGG - Exonic
1128649067 15:69397285-69397307 GTCACTTCCATTGGGGTGGGAGG + Intronic
1129013264 15:72442275-72442297 GTCACTTCAGCTGGAGTGGGAGG + Intergenic
1129880216 15:79001475-79001497 GCCCCTTCCCTTGGGGTGGCGGG + Intronic
1131030251 15:89180430-89180452 GTTAGTTCCACTGGGGTGGAAGG - Intronic
1132029256 15:98427181-98427203 GGTACTTGAATTGGGGTGGGAGG - Intergenic
1132777697 16:1604880-1604902 GTGACTTTCATTGAGATGGGAGG + Intronic
1133036628 16:3037052-3037074 GTCGCTTCCACCTGGGTGGGGGG + Intergenic
1133966474 16:10535709-10535731 GTCATTTAACTTGGGGTGGGGGG - Intronic
1134347279 16:13402488-13402510 GTCACCTACATTGGAGAGGGTGG + Intergenic
1136073954 16:27805223-27805245 GGCACTGGGATTGGGGTGGGGGG + Intronic
1136073983 16:27805288-27805310 GGCACTGGGATTGGGGTGGGGGG + Intronic
1136073997 16:27805320-27805342 GGCACTGGGATTGGGGTGGGGGG + Intronic
1136074011 16:27805352-27805374 GGCACTGGGATTGGGGTGGGGGG + Intronic
1136074025 16:27805384-27805406 GGCACTGGGATTGGGGTGGGGGG + Intronic
1136074069 16:27805482-27805504 GGCACTGGGATTGGGGTGGGGGG + Intronic
1136074083 16:27805514-27805536 GGCACTGGGATTGGGGTGGGGGG + Intronic
1136074097 16:27805546-27805568 GGCACTGGGATTGGGGTGGGGGG + Intronic
1136074126 16:27805611-27805633 GGCACTGGGATTGGGGTGGGGGG + Intronic
1136074140 16:27805643-27805665 GGCACTGGGATTGGGGTGGGGGG + Intronic
1136074169 16:27805708-27805730 GGCACTGGGATTGGGGTGGGGGG + Intronic
1136074183 16:27805740-27805762 GGCACTGGGATTGGGGTGGGGGG + Intronic
1138688239 16:58745368-58745390 GTCATTTCCAGTGGGGGTGGCGG + Intergenic
1140310139 16:73840948-73840970 GCCAATTCCTTTGGGGTGGAGGG - Intergenic
1141524355 16:84602192-84602214 TTCAGTTCAATGGGGGTGGGGGG + Intronic
1149778414 17:59377029-59377051 GTGGCTTCCATTGTGGAGGGTGG + Intronic
1151124049 17:71826081-71826103 GTCATTTACCTTGCGGTGGGGGG - Intergenic
1151515124 17:74588878-74588900 GGCCCTGCCCTTGGGGTGGGAGG - Intronic
1151531033 17:74704845-74704867 GGCCCTGCCCTTGGGGTGGGAGG - Intronic
1151821086 17:76497304-76497326 GTCACTGACAGTGGGGTGGGGGG - Intronic
1151876645 17:76870731-76870753 GTCCCTTCAGTTGAGGTGGGGGG + Intronic
1152315864 17:79579878-79579900 GTCACTGGCACTGTGGTGGGGGG + Intergenic
1152523172 17:80872415-80872437 CTGGCTTCCATGGGGGTGGGAGG - Intronic
1152537485 17:80959207-80959229 GGCACCTTCTTTGGGGTGGGGGG + Intronic
1154507329 18:15054848-15054870 GACACATCAATTGGGCTGGGAGG + Intergenic
1158427299 18:57352030-57352052 GGAGCTTCCTTTGGGGTGGGAGG + Exonic
1160144785 18:76354847-76354869 GCCTCTTCCATTGGGGAGTGAGG - Intergenic
1160324214 18:77927742-77927764 GTCACTTCAGCTGGAGTGGGAGG - Intergenic
1160603174 18:80029994-80030016 GGCCCTTCCATTGGGGTTGAAGG - Intronic
1161435235 19:4258955-4258977 GTCCCATCCATGAGGGTGGGAGG + Intronic
1164571623 19:29378886-29378908 TTCAGTTCCCTTGGTGTGGGTGG + Intergenic
1167534609 19:50041751-50041773 TTCACTGCCATCTGGGTGGGAGG - Exonic
1168353678 19:55689760-55689782 GCCGCTTTCGTTGGGGTGGGAGG + Intronic
1168622824 19:57892730-57892752 GTCACTGCAATGGGAGTGGGGGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
1168674464 19:58266962-58266984 GTCTCTTCAATATGGGTGGGAGG + Intronic
925106349 2:1295767-1295789 GTCTCCTGTATTGGGGTGGGAGG + Intronic
925805285 2:7642240-7642262 GGCACTTCCTGTGTGGTGGGGGG + Intergenic
930642344 2:53866502-53866524 TTTACTTCCATTGGACTGGGAGG + Intronic
930710217 2:54543781-54543803 GTCATTTTTTTTGGGGTGGGAGG - Intronic
938258665 2:129880031-129880053 GTCACTTCTGATGGGGTGTGCGG - Intergenic
939114828 2:138048634-138048656 GTCACTTCCTATGTGGTGGCAGG - Intergenic
939935819 2:148292521-148292543 GTCATTTTAATTGGGGTGAGAGG - Intronic
940471301 2:154104188-154104210 CTGAGTTCCATGGGGGTGGGGGG + Intronic
946153292 2:217790380-217790402 AACACGTCGATTGGGGTGGGTGG + Intergenic
946356504 2:219189019-219189041 GGGACTGACATTGGGGTGGGGGG - Intergenic
948907992 2:240988941-240988963 GTCAGTTCCAGAGGGGTGGCTGG + Intronic
1171396808 20:24839831-24839853 GTCAGTTCCCTTGAAGTGGGAGG - Intergenic
1174237816 20:49108538-49108560 TTCTCTTCCTTTGGGGGGGGGGG - Intergenic
1174707893 20:52675650-52675672 GTCACTTTCTTAGGAGTGGGTGG + Intergenic
1175481921 20:59318007-59318029 GACTCTTACAGTGGGGTGGGAGG - Intronic
1179133852 21:38661861-38661883 CTCCCTTCCCTTGGGGTGGGGGG - Intergenic
1181498713 22:23303029-23303051 GTGAATTAAATTGGGGTGGGGGG - Intronic
1185264705 22:49894886-49894908 GGCAGTGCCTTTGGGGTGGGTGG - Intergenic
949478537 3:4471569-4471591 GGCACTTTCTTGGGGGTGGGAGG + Intergenic
952943036 3:38457793-38457815 GCCACTTCCTTGGGGGAGGGCGG + Intronic
953209045 3:40858199-40858221 GTCACTCCCTTAGTGGTGGGTGG + Intergenic
953410667 3:42688854-42688876 GGCACTTCCTGTGGGGTGGAGGG - Exonic
955378469 3:58417554-58417576 GGCAGTTCCATTGGGTGGGGTGG + Intronic
963123887 3:141797770-141797792 GTGTCTTCCCTTGGGGTGGCCGG - Intronic
966809800 3:183833395-183833417 GTCTCTGCCATGGGGATGGGGGG + Intronic
970142282 4:12995731-12995753 GGCACTGCCATGGTGGTGGGGGG + Intergenic
974975655 4:68887995-68888017 GACACTGTCATTGAGGTGGGAGG + Intergenic
975081442 4:70285223-70285245 GTAACTTCTATTGAGGTGGGTGG - Intergenic
976268249 4:83205333-83205355 GTCCCTTCCATTTAGGTGTGAGG - Intergenic
980105269 4:128582584-128582606 GTCCCTTCCATCAGGGTTGGTGG + Intergenic
980316820 4:131212293-131212315 GTCAGCTACACTGGGGTGGGGGG - Intergenic
981743610 4:148030003-148030025 GTCACTAGCATTGGGGTTGGTGG - Intronic
982061730 4:151611208-151611230 GGCACTTGCACAGGGGTGGGTGG + Intronic
994619084 5:102141656-102141678 GTGACTTTCATTGGGGCTGGAGG - Intergenic
996749749 5:126876576-126876598 GTAGCTTCCATTGTGATGGGAGG - Intronic
997363174 5:133308214-133308236 GTGTCTTCCTTTGGGGTAGGGGG + Intronic
999052996 5:148544120-148544142 GTCAGTTAAATTGGGGTTGGGGG - Intronic
1000353779 5:160373633-160373655 GCCACATCCCTTGGGGTGGTGGG + Intergenic
1003210859 6:4065378-4065400 GTTAGCTCCAATGGGGTGGGTGG - Intronic
1003414612 6:5896801-5896823 GTCCCTTCCTCTAGGGTGGGAGG + Intergenic
1007437556 6:41826733-41826755 GTCACTTTGATTGGGTTTGGGGG - Intronic
1011292811 6:85794008-85794030 GTCAATTTCCTTGGGGTTGGGGG + Intergenic
1016386604 6:143536540-143536562 ATCATTTCCATTGTGGTGGGTGG - Intergenic
1019798711 7:3071992-3072014 GTCACTTGCAGTGGGTTGGGAGG + Intergenic
1020788400 7:12595458-12595480 GTCTGTTGCATTGGGGTGGGGGG + Intronic
1021436473 7:20623111-20623133 GAAACTTCAATTGGAGTGGGGGG + Intronic
1022018415 7:26376111-26376133 GCCACCGCCAGTGGGGTGGGGGG - Intergenic
1023157525 7:37265822-37265844 GCCATTTCCATGGGGGTGGCTGG + Intronic
1023238064 7:38112041-38112063 GGCACATACAGTGGGGTGGGGGG - Intergenic
1024747614 7:52426731-52426753 GTGTCTTCTATAGGGGTGGGAGG - Intergenic
1024994988 7:55267212-55267234 AGCTCTTCCACTGGGGTGGGTGG - Intergenic
1027509182 7:79057809-79057831 GACACTTCCATAGGGGTGGTTGG + Intronic
1028918657 7:96287391-96287413 CTCTCTTCCCTTGGGGTGGCTGG - Intronic
1029425315 7:100490712-100490734 GTCACCTCCATTGCGGTGGCAGG - Exonic
1032320373 7:130880814-130880836 GTCACTTCCCCTGGGGTTTGAGG + Intergenic
1032400069 7:131618667-131618689 GACACTTCCAGTGGGAAGGGAGG - Intergenic
1032501515 7:132403662-132403684 ATCACTTCCCATGGGGTGGGAGG - Intronic
1032760062 7:134932262-134932284 GTCTCTTCCATTGGGGTCACTGG + Intronic
1034015325 7:147577576-147577598 GTTTCTTCTATTGGGGTGGCAGG + Intronic
1034269918 7:149798437-149798459 GTCTCCCCCATGGGGGTGGGAGG + Intergenic
1035835726 8:2749925-2749947 GCCTCTTCCCTTGAGGTGGGAGG + Intergenic
1036201687 8:6775748-6775770 GTCCCTGCCATGGGGGAGGGAGG - Intergenic
1041290480 8:56303470-56303492 ATCACTTCCTGTGGGGTGAGGGG - Intronic
1041998508 8:64092298-64092320 GTCACAGCCATTGGAGGGGGTGG + Intergenic
1042748683 8:72134604-72134626 GTCAGCTGCATTGAGGTGGGGGG + Intergenic
1046698606 8:117373879-117373901 GTAACTTCCATTGGTTTGTGTGG - Intergenic
1047298677 8:123593789-123593811 ATCTCTTCCACTGGGGTGGAGGG - Intergenic
1048509383 8:135048677-135048699 GTCAGTTCCACTGTGGTGGGAGG - Intergenic
1048573177 8:135671598-135671620 GACACATCCTTTGGGGTGTGTGG + Intergenic
1049170815 8:141159575-141159597 GGCACTTCCATGTGAGTGGGAGG - Intronic
1051149105 9:14061508-14061530 GCCATTTCCATTAGGGTGGGTGG - Intergenic
1052793660 9:32902306-32902328 GTCGCTCTCAGTGGGGTGGGTGG - Intergenic
1056395366 9:86176540-86176562 GTTACTTCCACTGGGGAAGGCGG - Intergenic
1060551921 9:124489750-124489772 GGGACAGCCATTGGGGTGGGGGG - Intronic
1060780556 9:126409102-126409124 GTGACTTCCATTGTGGGGGGGGG + Intronic
1062304234 9:135893997-135894019 GTCACCTCCCGTTGGGTGGGGGG - Intronic
1062453675 9:136626091-136626113 GTCACTTCCAGAGTGGCGGGAGG - Intergenic
1062695425 9:137873488-137873510 GTCACAGCCCTTGCGGTGGGAGG - Intergenic
1191190127 X:57657762-57657784 GGCCCTTCCATTGGGGTTGAAGG + Intergenic
1191241308 X:58192083-58192105 GTCTCTTCCATTGGAATGTGTGG - Intergenic
1192632228 X:72786399-72786421 GTCGCCTCCAGTGGGCTGGGTGG + Intronic
1192649481 X:72934402-72934424 GTCGCCTCCAGTGGGCTGGGTGG - Intronic
1193294766 X:79821330-79821352 GGCCCTTCTATTGGGGTTGGAGG + Intergenic
1193708491 X:84851994-84852016 GTCACTTACATTTGGGAGAGAGG - Intergenic
1196809361 X:119616408-119616430 GTCACTTACACTTGGGTGAGTGG + Intronic
1197969774 X:132102436-132102458 GTCAGTTCCCCTGGGGGGGGTGG + Intronic
1201077777 Y:10199979-10200001 GTGCCGTCCATGGGGGTGGGAGG - Intergenic