ID: 1128649148

View in Genome Browser
Species Human (GRCh38)
Location 15:69397857-69397879
Sequence CCAAGGCAGCACCTGGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128649148_1128649156 -6 Left 1128649148 15:69397857-69397879 CCCACACCCAGGTGCTGCCTTGG 0: 1
1: 0
2: 2
3: 19
4: 333
Right 1128649156 15:69397874-69397896 CCTTGGTGGCACTTGAGGAGTGG 0: 1
1: 1
2: 1
3: 17
4: 251
1128649148_1128649158 19 Left 1128649148 15:69397857-69397879 CCCACACCCAGGTGCTGCCTTGG 0: 1
1: 0
2: 2
3: 19
4: 333
Right 1128649158 15:69397899-69397921 AGGAGATGACATAAGCACAGAGG 0: 1
1: 0
2: 0
3: 18
4: 316
1128649148_1128649157 -1 Left 1128649148 15:69397857-69397879 CCCACACCCAGGTGCTGCCTTGG 0: 1
1: 0
2: 2
3: 19
4: 333
Right 1128649157 15:69397879-69397901 GTGGCACTTGAGGAGTGGTTAGG 0: 1
1: 0
2: 0
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128649148 Original CRISPR CCAAGGCAGCACCTGGGTGT GGG (reversed) Intronic