ID: 1128650078

View in Genome Browser
Species Human (GRCh38)
Location 15:69404827-69404849
Sequence GCAGACTCCTAGGGAAAACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128650075_1128650078 -3 Left 1128650075 15:69404807-69404829 CCAGTAAGCTTGTGACAAATGCA 0: 1
1: 0
2: 7
3: 108
4: 829
Right 1128650078 15:69404827-69404849 GCAGACTCCTAGGGAAAACCAGG 0: 1
1: 0
2: 0
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128650078 Original CRISPR GCAGACTCCTAGGGAAAACC AGG Exonic
902872405 1:19322381-19322403 ACTGAGTCCTAGGGAAGACCAGG - Intronic
903212933 1:21828806-21828828 GCAGCCTCCTCGGGACAAGCGGG - Intronic
905199294 1:36305764-36305786 CCTAACTCCCAGGGAAAACCTGG + Intergenic
907706418 1:56836379-56836401 GGAGATTCCTAGGGAAGTCCAGG - Intergenic
911395829 1:97308149-97308171 GCAGTCACCTAGTGAAAATCAGG - Intronic
912889238 1:113510896-113510918 GCAGAATCCTAGAGAAATCAAGG - Intronic
916331436 1:163621866-163621888 GCAGCCTCCTAGATTAAACCAGG - Intergenic
921556208 1:216601289-216601311 GCAGACTCCCAGGGACTTCCTGG + Intronic
922037465 1:221863229-221863251 GCAGTGGCCTAGGGAACACCAGG - Intergenic
922094585 1:222432159-222432181 GCAGACTCCTAGGCAGACCAAGG + Intergenic
922350955 1:224734274-224734296 TCAGACTCCTAGGCAACGCCAGG + Intronic
923587953 1:235292180-235292202 GCAGACTCTTGGGGACAATCAGG - Intronic
923812473 1:237334670-237334692 GCAGACGCCCAGAGAAAACGGGG - Intronic
1063376460 10:5557418-5557440 GCAGACCCCAAGGGAAGCCCCGG - Intergenic
1065161605 10:22928141-22928163 GCAGAGGCCTGAGGAAAACCTGG + Intronic
1065167699 10:22997325-22997347 GGAGACTGCCCGGGAAAACCGGG + Intronic
1066329732 10:34407334-34407356 GCACACTCCTCTGGAAAACAAGG - Intronic
1069867096 10:71510846-71510868 GCAAGCTCCTAGGGCAATCCTGG + Intronic
1069881246 10:71595232-71595254 GAAGGCTGCTAGGGAAAAGCAGG + Intronic
1070329233 10:75405927-75405949 GCACACTCCTGGGGCAACCCGGG - Intergenic
1072225901 10:93368398-93368420 GCAGACTCCCAGGGGCACCCTGG - Intronic
1073068817 10:100780672-100780694 GCACACTCCTGGGGAACATCAGG + Intronic
1076713304 10:132350896-132350918 GAAAACACCTGGGGAAAACCAGG - Intronic
1077143102 11:1033484-1033506 GCAGACCCCTCAGGGAAACCAGG - Intronic
1079129441 11:17738770-17738792 GCGGACTCTGAGGGAAAAGCTGG + Intronic
1081044550 11:38255500-38255522 GCAGTCTCATTGGGAAGACCTGG - Intergenic
1083431064 11:62613647-62613669 CCAGACTCCCAGGCAAAGCCAGG - Exonic
1084742154 11:71146784-71146806 ACAGCCTCATAGAGAAAACCCGG - Intronic
1088740415 11:112762458-112762480 GCAGCCTCCCAGGTAAGACCAGG + Intergenic
1088913165 11:114207349-114207371 GGAGATTCCTATGGATAACCAGG + Intronic
1088925205 11:114294988-114295010 GCTGACTCCTTGGAAAAAACCGG + Intronic
1089805866 11:121088221-121088243 ACAAAGTCCCAGGGAAAACCTGG - Exonic
1092072635 12:5645060-5645082 GAAGAATCCTAGTGAAACCCAGG - Intronic
1092406182 12:8223589-8223611 CCCGTCTCCTGGGGAAAACCAGG - Intronic
1093033799 12:14314207-14314229 CAAGAATCCTAGGGAACACCTGG + Intergenic
1093289229 12:17301087-17301109 GCTGACTCTTAGGCAAAAGCTGG + Intergenic
1094414405 12:30201912-30201934 GCAGACACCTCGGGAAACTCTGG - Intergenic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1101209808 12:102524489-102524511 GCAGACTAGTAGGGGAAACAGGG + Intergenic
1102675233 12:114653449-114653471 GCAGACTCCCAGGAAAAACAAGG - Intergenic
1106949966 13:34872383-34872405 GCACTCTCCTAGGGACATCCCGG - Intergenic
1106986776 13:35362472-35362494 GCACATTTCTAGGTAAAACCTGG - Intronic
1109498264 13:63204002-63204024 GAAGACTGCTGGGGACAACCTGG + Intergenic
1113239908 13:108326033-108326055 ACAGACTCCTGGGCAAGACCAGG - Intergenic
1119411646 14:74435221-74435243 GCAGTCTTCCAGGGACAACCAGG + Intergenic
1123106576 14:105844603-105844625 GCAGACTCCCAGAGCAGACCTGG - Intergenic
1128650078 15:69404827-69404849 GCAGACTCCTAGGGAAAACCAGG + Exonic
1131836054 15:96392323-96392345 GCAGAATTCTAGGAGAAACCTGG + Intergenic
1133335546 16:5004555-5004577 GCAGAATCCTGGGGAAAGCTGGG + Intronic
1137751930 16:50869466-50869488 GGAGACTTCAAGGGAATACCGGG - Intergenic
1139348423 16:66320101-66320123 CCAGAATCCTCGGGAAAAACTGG + Intergenic
1142629657 17:1216574-1216596 CCAGATTGCTAGGTAAAACCTGG + Intronic
1143396774 17:6605519-6605541 GAAGACTCCTAGGGGAAGACAGG - Intronic
1145819183 17:27818296-27818318 GCAGACTCCAAGGATAATCCCGG + Intronic
1146590207 17:34122231-34122253 TCAGCCTCCTTGGGAATACCAGG - Intronic
1151093695 17:71471540-71471562 ACATATTCCTAAGGAAAACCAGG + Intergenic
1151367178 17:73625260-73625282 ACAGTCTCCTAGGCAAAACTGGG + Intronic
1151398810 17:73842524-73842546 GCAGATTCTTAGGGAAAAATGGG - Intergenic
1151733334 17:75923597-75923619 GCAGACCCCAAGGGAGAACCAGG - Exonic
1152596854 17:81241997-81242019 TCAGACCCTTAGGGGAAACCAGG - Intergenic
1156248304 18:35325082-35325104 GGAGAATTCTAGGGAAAACCAGG - Intergenic
1157028916 18:43880698-43880720 GCATAATCTTGGGGAAAACCTGG + Intergenic
1158546862 18:58404474-58404496 GCAGATTTCCTGGGAAAACCTGG - Intergenic
1163837260 19:19582466-19582488 GCAGACACCAAGGGAAATCCAGG + Intronic
1164843672 19:31413593-31413615 GCAGACTGCTGGGAAAAACTGGG + Intergenic
927991435 2:27450225-27450247 GCACCCTCCTGGGCAAAACCTGG + Intronic
929452275 2:42046134-42046156 TCAGACCCCTGGGGAAAACGGGG - Intergenic
933466980 2:82664615-82664637 GCAGACTGCTAAGAAAACCCTGG + Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
935555719 2:104507894-104507916 GCAGACTGCAAAGGAAAACTGGG - Intergenic
935627877 2:105185975-105185997 GCAGGCACCTAGGTTAAACCAGG + Intergenic
944620011 2:201504777-201504799 CCAGCATCCCAGGGAAAACCTGG - Intronic
945974096 2:216257561-216257583 GCAGAATCCTTGGGAGAGCCTGG + Intergenic
946962082 2:224996202-224996224 GCCGACTCCTAGTGATCACCAGG - Intronic
948709086 2:239814191-239814213 GGAGACTCCTAGGCTAAACCTGG + Intergenic
1169506784 20:6220056-6220078 TCAGCATCCCAGGGAAAACCAGG + Intergenic
1170753177 20:19170834-19170856 ACATTCACCTAGGGAAAACCAGG + Intergenic
1171238702 20:23548085-23548107 GCAGCCTCCAGGGGAAACCCAGG + Intergenic
1172091619 20:32436759-32436781 ACAGACTCCAAGGGAAGACTGGG + Exonic
1172144917 20:32750226-32750248 CCTTTCTCCTAGGGAAAACCTGG - Intergenic
1175299724 20:57934393-57934415 GCAGACCCCTGGGGGAAAGCTGG + Intergenic
1178533858 21:33396705-33396727 GCAGACTTCCAGGAAAAACCTGG - Intergenic
1179032824 21:37735367-37735389 GCAAACCCATAGGGAAAAACTGG - Intronic
1179797568 21:43794279-43794301 GCAGACTCTTAGGGACAATGGGG + Intronic
950124359 3:10502438-10502460 TCAAACACCTGGGGAAAACCAGG + Intronic
950577017 3:13838081-13838103 GCAGACGCATAGAGATAACCGGG - Intronic
951979241 3:28547365-28547387 GCTGTCACCAAGGGAAAACCAGG - Intergenic
953107188 3:39895156-39895178 GCAAAAATCTAGGGAAAACCAGG - Intronic
953847381 3:46438511-46438533 GCAGGCTGCTAGGAAAACCCAGG + Intronic
954354420 3:50072962-50072984 GAAGAGTCCTAGAGAACACCTGG - Intronic
962091327 3:132246893-132246915 GCAGACACTTAGTGAAAATCAGG - Intronic
962426541 3:135273673-135273695 GCTGCCTCCTTGGTAAAACCGGG + Intergenic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
966732708 3:183163708-183163730 GCAGACTCCCTGGGAAGACATGG - Intronic
967126784 3:186431136-186431158 GCACACTCCAAGGAAATACCAGG - Intergenic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
972125290 4:35758004-35758026 GCAGACTCTCAGTGGAAACCTGG - Intergenic
972598686 4:40552680-40552702 GCAGGCTCCTAGAGGGAACCTGG - Intronic
976659856 4:87529322-87529344 CCAGCCTGCTAGGGAAATCCAGG - Exonic
986227018 5:5825236-5825258 GCAGGCTGCTGGTGAAAACCAGG + Intergenic
987054077 5:14174412-14174434 GCCGACCCCTAGGGAGAAACAGG - Intronic
987162588 5:15159668-15159690 GCAGAGTGCTAGGATAAACCCGG - Intergenic
987502509 5:18731912-18731934 GCAGACTACTAGGGAAAGGATGG - Intergenic
990791489 5:59485032-59485054 CCAGTCTCCTAGGGAAGACTAGG + Intronic
992845162 5:80739441-80739463 CCATCTTCCTAGGGAAAACCAGG - Intronic
995838312 5:116420290-116420312 GCAGAGTCCTAGAGATGACCTGG + Intergenic
996716899 5:126595334-126595356 GCAGGCTCCTCCGGAAGACCAGG - Exonic
998172629 5:139881441-139881463 CCAGACTCCTAGTCCAAACCTGG + Intronic
1001953453 5:175831993-175832015 GCAGAGTCCTAGGGTAGACCAGG - Intronic
1002863180 6:1097670-1097692 CCAGACTCATAGGTAAAACCGGG + Intergenic
1004730488 6:18353410-18353432 GAAAAGTCCTAGGGAAATCCCGG - Intergenic
1005522128 6:26610784-26610806 GCATATTCCCAGGGAAAAGCAGG + Intergenic
1006361464 6:33589547-33589569 GCAGCCTCCTAGGGAGGATCCGG + Intergenic
1009253582 6:61345031-61345053 TCAGACTCCTATGGAGAAACAGG + Intergenic
1009258268 6:61446852-61446874 TCAGACTCCTATGGAGAAACAGG + Intergenic
1013304235 6:108833344-108833366 GCAGACTTCCAGGGAAAGCTTGG - Intergenic
1015818887 6:137239068-137239090 GCAGACTCCTGGTGGAAACCAGG - Intergenic
1024263420 7:47588572-47588594 GCAGGCTCCTAGCAGAAACCTGG - Intergenic
1029863270 7:103598469-103598491 GCAAACTCCTGTGAAAAACCTGG + Intronic
1030822452 7:114112008-114112030 GCAGAGTCCTAGGAAGAACAGGG + Intronic
1033529472 7:142247737-142247759 GCACACTCCTAGGGAGGAGCAGG + Intergenic
1036263557 8:7258125-7258147 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036264858 8:7265747-7265769 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036266159 8:7273369-7273391 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036267460 8:7280991-7281013 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036268762 8:7288613-7288635 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036270066 8:7296235-7296257 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036297830 8:7550820-7550842 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036299134 8:7558468-7558490 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036300439 8:7566118-7566140 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036301742 8:7573762-7573784 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036303039 8:7581411-7581433 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036315598 8:7716664-7716686 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036316906 8:7724312-7724334 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036318213 8:7731960-7731982 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036319522 8:7739607-7739629 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036320829 8:7747255-7747277 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036322139 8:7754903-7754925 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036323448 8:7762551-7762573 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036324743 8:7770198-7770220 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036351291 8:8014109-8014131 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036352596 8:8021755-8021777 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036353888 8:8029403-8029425 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036846558 8:12174528-12174550 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1041049105 8:53915695-53915717 GAAGACTCCTGGGGAGAACCTGG - Intronic
1045222675 8:100213649-100213671 ACAGCCACCAAGGGAAAACCCGG - Intronic
1048519620 8:135141542-135141564 GCAGACCCCAAGGGAGAACAGGG + Intergenic
1049240987 8:141537237-141537259 CCAGACTCCCAGGGAGACCCAGG - Intergenic
1049617399 8:143581658-143581680 TCACAGTCCTAGGGACAACCTGG + Intronic
1050766286 9:9139137-9139159 TGAGACTCCTAGTGAATACCTGG + Intronic
1051284085 9:15477020-15477042 GCATACTCCGGGGGAAAACTGGG + Intronic
1056552491 9:87663592-87663614 GCAGAGGCCTAGGGAGAAGCAGG - Intronic
1057503269 9:95612603-95612625 GGATAATCCTAGGGAAAACTAGG + Intergenic
1060681576 9:125569638-125569660 ACAGCCTCCTTGGGAAAAACAGG + Intronic
1186285769 X:8042500-8042522 GCAGCCTCCTAAGGAGAACATGG - Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191241380 X:58192660-58192682 AAAGACTCCTGGTGAAAACCAGG + Intergenic
1194079439 X:89440524-89440546 GCAGATTTTGAGGGAAAACCAGG + Intergenic
1197012840 X:121588120-121588142 ACAGAATCCTAAGGAATACCAGG + Intergenic
1200432057 Y:3095829-3095851 GCAGATTTTGAGGGAAAACCAGG + Intergenic
1201467080 Y:14294348-14294370 GCAGAATCCTAGGGCAATGCAGG - Intergenic