ID: 1128651184

View in Genome Browser
Species Human (GRCh38)
Location 15:69414694-69414716
Sequence CGCCCCGCCTGGGCCTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1179
Summary {0: 1, 1: 0, 2: 0, 3: 57, 4: 1121}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128651174_1128651184 -7 Left 1128651174 15:69414678-69414700 CCGCGTCGCCCCCCGCCGCCCCG 0: 1
1: 0
2: 18
3: 145
4: 1131
Right 1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG 0: 1
1: 0
2: 0
3: 57
4: 1121
1128651173_1128651184 -3 Left 1128651173 15:69414674-69414696 CCTGCCGCGTCGCCCCCCGCCGC 0: 1
1: 0
2: 6
3: 78
4: 651
Right 1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG 0: 1
1: 0
2: 0
3: 57
4: 1121
1128651167_1128651184 27 Left 1128651167 15:69414644-69414666 CCGCTCCGCGGGAGCCTGGGCGC 0: 1
1: 0
2: 2
3: 17
4: 223
Right 1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG 0: 1
1: 0
2: 0
3: 57
4: 1121
1128651171_1128651184 -1 Left 1128651171 15:69414672-69414694 CCCCTGCCGCGTCGCCCCCCGCC 0: 1
1: 0
2: 4
3: 37
4: 543
Right 1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG 0: 1
1: 0
2: 0
3: 57
4: 1121
1128651170_1128651184 13 Left 1128651170 15:69414658-69414680 CCTGGGCGCGGAGACCCCTGCCG 0: 1
1: 0
2: 2
3: 28
4: 172
Right 1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG 0: 1
1: 0
2: 0
3: 57
4: 1121
1128651172_1128651184 -2 Left 1128651172 15:69414673-69414695 CCCTGCCGCGTCGCCCCCCGCCG 0: 1
1: 0
2: 0
3: 21
4: 244
Right 1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG 0: 1
1: 0
2: 0
3: 57
4: 1121
1128651169_1128651184 22 Left 1128651169 15:69414649-69414671 CCGCGGGAGCCTGGGCGCGGAGA 0: 1
1: 0
2: 1
3: 14
4: 222
Right 1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG 0: 1
1: 0
2: 0
3: 57
4: 1121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128651184 Original CRISPR CGCCCCGCCTGGGCCTCCAA GGG Intronic
900029513 1:360738-360760 CCTCCCACCTGGGCCTCCAAAGG + Intergenic
900050114 1:589509-589531 CCTCCCACCTGGGCCTCCAAAGG + Intergenic
900132211 1:1091948-1091970 CGCCCCACCCGTGCCTCCAAAGG - Intronic
900169227 1:1258282-1258304 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
900284950 1:1894580-1894602 AGACCCCCCTGGGCCACCAAGGG - Intergenic
900365526 1:2310590-2310612 CTTCCCGGCTGGGCCTCCACGGG + Intergenic
900569211 1:3350087-3350109 CCTCCCGCCTTGGCCTCCCAAGG - Intronic
900640033 1:3684223-3684245 CGCCCCGCCTCCGCCGCCCAGGG + Intronic
900733982 1:4283277-4283299 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
901189837 1:7403107-7403129 CCCCCCACCTAGGCCTCCCAAGG - Intronic
901303652 1:8217277-8217299 CGCCGCCGCTGGGCCTTCAAAGG - Intergenic
901378048 1:8853868-8853890 CCTCCCGCCTCGGCCTCCCAAGG - Intergenic
901463154 1:9403731-9403753 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
901675513 1:10881361-10881383 CCACCCGCCTGGGCCTCCCAAGG - Intergenic
901782392 1:11602569-11602591 AGCCCTGCCTGGCCCTCCCAGGG + Intergenic
901903971 1:12392103-12392125 CTGCCCGCCTAGGCCTCCCAGGG + Intronic
902498183 1:16889391-16889413 CGAGCCGCCTGGGGCCCCAAGGG - Intronic
902519614 1:17008704-17008726 CGCCCCCCTTGGGCTCCCAAAGG - Intronic
902874916 1:19335184-19335206 CCTCCCGCCTTGGCCTCCCAAGG - Intergenic
902882353 1:19380924-19380946 CCTCCCGCCTCGGCCTCCCAAGG - Intronic
902954998 1:19919509-19919531 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
903397305 1:23011666-23011688 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
903416161 1:23184689-23184711 CCACCTGCCTCGGCCTCCAAAGG + Intergenic
903511839 1:23881643-23881665 CCGCCCGCCTCGGCCTCCAAAGG - Intronic
903619420 1:24687084-24687106 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
903912537 1:26738264-26738286 CCACCCGCCTCGGCCTCCCAAGG + Intronic
904725469 1:32543917-32543939 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
905103972 1:35551560-35551582 CCACCCGCCTCGGCCTCCCAAGG + Intronic
905186276 1:36199315-36199337 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
905364268 1:37440352-37440374 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
905392267 1:37644408-37644430 CCTCCCGCCTTGGCCTCCCAAGG + Intergenic
905511503 1:38524953-38524975 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
905573821 1:39027313-39027335 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
905595589 1:39204028-39204050 CCTCCCGCCTCTGCCTCCAAAGG - Intronic
905982694 1:42244936-42244958 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
905997588 1:42394980-42395002 CCACCCGCCTTGGCCTCCCAAGG + Intronic
906418216 1:45639631-45639653 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
906472269 1:46141101-46141123 CGTCCCACCTTGGCCTCCCAAGG + Intronic
907014836 1:51002537-51002559 CCTCCCGCCTCGGCCTCCCAGGG + Intergenic
907080949 1:51621256-51621278 CTCCCCGCCTCGGCCTCCCAAGG - Intronic
907212689 1:52837160-52837182 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
907788329 1:57635850-57635872 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
907995420 1:59626612-59626634 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
908314149 1:62916347-62916369 CTACCCGCCTTGGCCTCCCAAGG + Intergenic
908414547 1:63900208-63900230 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
909338137 1:74500356-74500378 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
910029054 1:82694116-82694138 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
910967817 1:92825361-92825383 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
912145684 1:106791356-106791378 CTACCCGCCTTGGCCTCCCATGG - Intergenic
912423691 1:109566804-109566826 CCACCCGCCTCGGCCTCCCAAGG + Intronic
912539063 1:110398619-110398641 CCTCCCGCCTCGGCCTCCCAAGG - Intergenic
912672374 1:111642728-111642750 CCACCCGCCTTGGCCTCCCAAGG + Intronic
913222401 1:116669547-116669569 CCCCCTGCCTTGGCCTCCCAAGG - Intergenic
913679124 1:121172086-121172108 CTGCCCACCTTGGCCTCCAAAGG - Intronic
913698807 1:121354639-121354661 CTGCCCACCTGGGCCTCAAAAGG + Intronic
914030956 1:143959730-143959752 CTGCCCACCTTGGCCTCCAAAGG - Intronic
914138738 1:144925398-144925420 CTGCCCACCTGGGCCTCAAAAGG - Intronic
914158493 1:145108230-145108252 CTGCCCACCTTGGCCTCCAAAGG + Intronic
914490088 1:148146363-148146385 CGCCCGGGCCGGGCCTCCACCGG - Intronic
914701240 1:150136003-150136025 CCACCCGCCTTGGCCTCCCAAGG - Intronic
914752710 1:150546594-150546616 CCGCCCGCCTTGGCCTCCGAAGG + Intergenic
914837075 1:151216103-151216125 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
915015859 1:152732635-152732657 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
915198014 1:154204803-154204825 CCCCCTGCCTCGGCCTCCCAAGG + Intronic
915419759 1:155770603-155770625 CCACCCGCCTTGGCCTCCCAAGG - Intronic
915425752 1:155825327-155825349 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
915549489 1:156624206-156624228 CGCCTCGCCTGGGTCTCCCAGGG + Intronic
915962851 1:160281647-160281669 CCACCCGCCTCGGCCTCCCAAGG + Intronic
916483656 1:165237458-165237480 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
916654488 1:166861809-166861831 CTTCCCGCCTTGGCCTCCCAAGG - Intronic
916675005 1:167057953-167057975 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
917022493 1:170604063-170604085 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
917789299 1:178489117-178489139 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
917796471 1:178536543-178536565 CCACCCGCCTCGGCCTCCCAAGG - Intronic
917858512 1:179122361-179122383 CCTCCTGCCTGGGCCTCCCAAGG + Intronic
917921899 1:179757566-179757588 CCACCCACCTGGGCCTCCTAAGG - Intronic
918289500 1:183093033-183093055 CCTCCCACCTGGGCCTCCCAAGG - Intronic
919126125 1:193395839-193395861 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
919491387 1:198210039-198210061 CCGCCTGCCTGGGCCTCCCAAGG + Intronic
919707399 1:200690529-200690551 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
919725140 1:200877521-200877543 CCCCCCACCTTGGCCTCCCAAGG + Intergenic
919903005 1:202057621-202057643 CCACCCGCCTCGGCCTCCCAGGG - Intergenic
919903545 1:202061502-202061524 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
919950330 1:202357063-202357085 CCACCCGCCTTGGCCTCCCAAGG + Intronic
920173153 1:204084011-204084033 GGCCCCACCTGGGCCTCTAAGGG + Intronic
920175397 1:204098232-204098254 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
920399753 1:205669523-205669545 CCCCCAGCCTGGGCTTCCACGGG - Intronic
920466422 1:206190624-206190646 CTGCCCACCTTGGCCTCCAAAGG - Intronic
920486216 1:206373337-206373359 CTGCCCACCTGGGCCTCAAAAGG + Intronic
920896226 1:210052417-210052439 CCGCCCGCCTCGGCCTCCCAGGG - Intronic
921109036 1:212014786-212014808 CTGCCCGCCTGGGCCTCCCGAGG + Intronic
921247434 1:213259314-213259336 CCACCCGCCTTGGCCTCCCAAGG - Intronic
921629104 1:217412717-217412739 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
922306641 1:224350416-224350438 CTGCCCGCCTGTGCCTCCCACGG - Intergenic
922319273 1:224471271-224471293 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
922624509 1:227024997-227025019 CTGCCCGCCTCGGCCTCCCACGG - Intronic
922644769 1:227275845-227275867 CTGCCCGCCTGGGCCTCCCGAGG + Intronic
922753243 1:228080911-228080933 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
922785361 1:228279844-228279866 CGCCCTGTCTTGGGCTCCAACGG - Exonic
922959443 1:229634074-229634096 CGCCCCGACTCAGCCTCCCAAGG + Intronic
923792335 1:237122436-237122458 CCCCCCGCCTCGACCTCCCAAGG - Intronic
923901163 1:238327420-238327442 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
924527871 1:244868170-244868192 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
924541021 1:244980937-244980959 CCACCCGCCTGGGCCTCCCAAGG - Intronic
924554160 1:245104258-245104280 CTGCCCGCCTGGGCCTCCCAAGG - Intronic
924620354 1:245654764-245654786 CGCCCCTCCTGGGTATGCAAAGG + Intronic
1062868803 10:880441-880463 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
1064014036 10:11759108-11759130 CCACCCGCCTTGGCCTCCCACGG - Intronic
1064059410 10:12125293-12125315 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1064115666 10:12575332-12575354 CCACCCGCCTTGGCCTCCTAAGG + Intronic
1064462557 10:15549452-15549474 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1064589438 10:16873476-16873498 CCTCCCGCCTCGGCCTCCCATGG - Intronic
1064768102 10:18695569-18695591 CCGCCCGCCTTGGCCTCCCAAGG + Intergenic
1064783432 10:18867916-18867938 CCTCCTGCCTTGGCCTCCAAAGG + Intergenic
1064999089 10:21320890-21320912 CGGCCCTCCTCGGCCTCCCAGGG - Intergenic
1065029206 10:21568059-21568081 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1065099515 10:22320602-22320624 CGCCCCGCCTCGGCCGCCCGCGG + Intronic
1065272393 10:24048485-24048507 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1065476990 10:26149476-26149498 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1065884489 10:30064911-30064933 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1066396374 10:35027385-35027407 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1066563380 10:36693481-36693503 CTGCCCGCCTCGGCCTCCAAAGG - Intergenic
1066571784 10:36781574-36781596 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
1066572742 10:36791120-36791142 CCGCCCGCCTGGGCCTCCCAAGG - Intergenic
1067271351 10:44794121-44794143 CCTCCCGCCTCGGCCTCCTAAGG - Intergenic
1067333884 10:45346422-45346444 CTGCCCGCCTCGGCCTCCCAGGG + Intergenic
1067383194 10:45794153-45794175 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
1067407302 10:46034580-46034602 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1067890899 10:50134702-50134724 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
1068119962 10:52775051-52775073 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1068458725 10:57297067-57297089 CTTCCCGCTTGGGCCTCCCAAGG + Intergenic
1068504463 10:57882424-57882446 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1069035533 10:63642485-63642507 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1069272859 10:66552144-66552166 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1069439929 10:68418914-68418936 CCACCCGCCTTGGCCTCCCAGGG + Intronic
1070020794 10:72583522-72583544 CCCCCTGCCTTGGCCTCCCAAGG + Intronic
1070067704 10:73054147-73054169 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1070308031 10:75251398-75251420 CACCCCTCCTTGGCCTCCCAAGG - Intergenic
1071453655 10:85824453-85824475 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1071563775 10:86661408-86661430 CCCCACACCTTGGCCTCCAAGGG + Intronic
1071592156 10:86884656-86884678 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1071686729 10:87765782-87765804 CCCCCCGCCTTGGCCTCCCAAGG - Intronic
1071829820 10:89360635-89360657 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1072163656 10:92790984-92791006 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1072195927 10:93117205-93117227 CCTCCCGCCTTGGCCTCCTAAGG + Intergenic
1072204969 10:93195534-93195556 CCCCCCACCTTGGCCTCCCAAGG - Intergenic
1072334681 10:94387434-94387456 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1072947162 10:99820512-99820534 CCTTCCGCCTTGGCCTCCAAAGG - Intronic
1073026079 10:100488214-100488236 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1073095252 10:100975612-100975634 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1073118341 10:101106076-101106098 CACCGTGCCTGGCCCTCCAATGG - Intronic
1073233221 10:101990412-101990434 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1073265342 10:102224904-102224926 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1073385812 10:103127797-103127819 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1074392307 10:113068606-113068628 CTCCACGTCTGGGCCTCCCAAGG - Intronic
1074518370 10:114193535-114193557 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1074738399 10:116460007-116460029 CCACCCGCCTCGGCCTCCGAGGG + Intronic
1074913330 10:117932120-117932142 CGGCCCACCTCGGCCTCCCAAGG - Intergenic
1075147201 10:119892546-119892568 CGCCCGGCCTCCGCCTCCGAGGG + Intronic
1075561839 10:123473870-123473892 CGCCCTGCCTGTTCCTTCAAAGG + Intergenic
1075678831 10:124318072-124318094 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
1075699160 10:124457592-124457614 CCGCCCGCCTTGGCCTCCCAAGG + Intergenic
1075808477 10:125207162-125207184 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1075919080 10:126195329-126195351 CCACCCACCTGGGCCTCCCAAGG - Intronic
1076326017 10:129623762-129623784 CTTCCTGCCTTGGCCTCCAAAGG + Intronic
1076692317 10:132230139-132230161 CGCCCCGCCCCGCCCTCCCAAGG - Intronic
1076708670 10:132318370-132318392 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1076943004 10:133622470-133622492 CCGCCCGCCTCGGCCTCCCACGG + Intergenic
1077029422 11:457513-457535 CCTCCTGCCTGGGCCTCCCAAGG + Intronic
1077041770 11:527943-527965 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1077104034 11:834113-834135 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1077133906 11:989076-989098 CCGCCCGCCTTGGCCTCCCAAGG - Intronic
1077196695 11:1284590-1284612 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1077402663 11:2366843-2366865 GGCCAAGCCTGGGCCTCCAGTGG - Intergenic
1077680649 11:4237414-4237436 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1077684930 11:4282812-4282834 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1077690260 11:4335118-4335140 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1079080294 11:17409198-17409220 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1079375178 11:19886219-19886241 CCTCCCGCCTTGGCCTCCCAGGG + Intronic
1079624671 11:22601837-22601859 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1080013332 11:27479743-27479765 CAGCCAGCCTGGGCCTCCCAAGG - Intergenic
1080139937 11:28904641-28904663 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1080755916 11:35198733-35198755 CTGCCCGCCTCGGCCTCCCAGGG - Intronic
1080776380 11:35390907-35390929 CTGCCCGCCTCGGCCTCCGATGG + Intronic
1080837647 11:35954999-35955021 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1080840955 11:35983095-35983117 CTACCCGCCTTGGCCTCCCAAGG + Intronic
1081113382 11:39165780-39165802 CAACCCGCCTTGGCCTCCTAAGG - Intergenic
1081238157 11:40671004-40671026 CCGCCCGCCTTGGCCTCCCAAGG + Intronic
1081649095 11:44811703-44811725 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1082034438 11:47633351-47633373 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1083029676 11:59580760-59580782 CCTCCCGCCTTGGCCTCCCAAGG + Intronic
1083250400 11:61463160-61463182 CCGCCCGCCTTGGCCTCCCAAGG - Intronic
1083675920 11:64324548-64324570 CCACCCGCCTTGGCCTCCCACGG - Intergenic
1083991916 11:66251527-66251549 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1084566685 11:69932615-69932637 GGCCTCGCCTGGGCCTGCCAAGG + Intergenic
1084619274 11:70257732-70257754 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1084658077 11:70530920-70530942 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1085073333 11:73568651-73568673 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
1085159556 11:74328048-74328070 CTGCCCGCCTGGGCCTCCCGAGG + Intergenic
1085208382 11:74750843-74750865 CCGCCCGCCTTGGCCTCCCAAGG + Intronic
1085421992 11:76370604-76370626 CGTCCTGCCTCGGCCTCCCAAGG + Intronic
1085446154 11:76602579-76602601 CTCCCCTCCTGGGCCTCCTGGGG + Intergenic
1085513626 11:77100078-77100100 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1085702205 11:78755410-78755432 CTGCCCGCCTGAGCCTCCCAGGG + Intronic
1085822731 11:79810406-79810428 CCACCCGCCTTGGCCTCCAAAGG - Intergenic
1086165748 11:83775847-83775869 CCGCCCGCCTTGGCCTCCCAAGG - Intronic
1086459460 11:86991827-86991849 TGACCCGCTTGGGCCTCCCAAGG + Intergenic
1086474177 11:87152680-87152702 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1086728777 11:90222751-90222773 TGCCCCTCCTGGGCCTCCCTTGG - Intronic
1086818149 11:91399777-91399799 CAGCCCACCTGGGCCTCCCAAGG + Intergenic
1086834622 11:91605197-91605219 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1087755043 11:102046584-102046606 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1087863471 11:103193789-103193811 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1088147524 11:106700024-106700046 CCGCCCGCCTCGGCCTCCCAGGG + Intronic
1088244104 11:107800129-107800151 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1088794935 11:113259945-113259967 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1089721463 11:120427457-120427479 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1089818345 11:121197693-121197715 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1089958919 11:122598663-122598685 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1090841847 11:130496877-130496899 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
1091168139 11:133498517-133498539 CGCACCATCTGGGCCTCCCAGGG + Intronic
1091383652 12:78316-78338 CGCCCCTCCTCGGCCTCCACGGG + Intronic
1091547121 12:1508692-1508714 CCGCCCGCCTGGGCCTCCCAAGG - Intergenic
1091764717 12:3111853-3111875 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1091846830 12:3662706-3662728 CACACAGCCTGGGTCTCCAATGG - Intronic
1092203003 12:6598565-6598587 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1092361528 12:7840627-7840649 CCGCCCACCTGGGCCTCCCAAGG + Intronic
1092370034 12:7909164-7909186 CTGCCCGCCTTGGCCTCCTAAGG - Intergenic
1092527956 12:9321209-9321231 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
1092607073 12:10132273-10132295 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1092831474 12:12448456-12448478 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1092850122 12:12618783-12618805 CTGCCCGCCTGGGCCTCCCGAGG - Intronic
1094130419 12:27068883-27068905 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1094546226 12:31407041-31407063 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1095394881 12:41750488-41750510 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1095889942 12:47226616-47226638 CCGCCCGCCTTGGCCTCCTAAGG + Intronic
1095907697 12:47394577-47394599 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1096083487 12:48849251-48849273 CCTCCCGCCTTGGCCTCCCAAGG - Intronic
1096130740 12:49157029-49157051 CTGCCCGCCTGGACCTCCCAAGG + Intergenic
1096332683 12:50728135-50728157 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
1096336402 12:50760041-50760063 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1096489778 12:52007154-52007176 CGCCACCCCTGGGCCCCCAGCGG + Exonic
1097228734 12:57495753-57495775 CTGCCCGCCTGGGCCTCCTGAGG - Intronic
1097255861 12:57673666-57673688 CCGCCCGCCTTGGCCTCCCAAGG + Intergenic
1097361368 12:58662041-58662063 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1097392051 12:59026858-59026880 CCTCCCGCCTCGGCCTCCTAGGG + Intergenic
1098288205 12:68930323-68930345 CCTCCCGCCTCGGCCTCCCAAGG + Intronic
1098358216 12:69630750-69630772 TGCCCCGCCTCTGCTTCCAATGG - Intergenic
1098397910 12:70041949-70041971 CGGCCTGCCTCGGCCTCCCACGG + Intergenic
1098428348 12:70391547-70391569 CCCCCTGCCTTGGCCTCCGAAGG + Intronic
1099233009 12:80049568-80049590 CCACCCGCCTCGGCCTCCAAAGG - Intergenic
1099541452 12:83913972-83913994 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1100298522 12:93285352-93285374 CCCGCCGCCTCGGCCTCCCAAGG - Intergenic
1101131220 12:101693187-101693209 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1101885750 12:108660206-108660228 CTGCCCGCCTCGGCCTCCCAGGG - Intronic
1102230477 12:111258267-111258289 CCGCCCGCCTTGGCCTCCCAAGG - Intronic
1102771388 12:115480237-115480259 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
1102846526 12:116190846-116190868 CCACCCGCCTTGGCCTCCCACGG - Intronic
1102867481 12:116385680-116385702 CCACCCGCCTCAGCCTCCAAAGG + Intergenic
1102871394 12:116416899-116416921 CCTCCCGCCTTGGCCTCCCAAGG - Intergenic
1102927350 12:116836304-116836326 CCCCCAGCCTTGGTCTCCAATGG - Intronic
1102941035 12:116942262-116942284 CCTCCTGCCTCGGCCTCCAAAGG + Intronic
1102958566 12:117076058-117076080 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1103138662 12:118529669-118529691 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1103151185 12:118640368-118640390 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1103450999 12:121028819-121028841 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1103655347 12:122466246-122466268 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1103692197 12:122784277-122784299 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1103785437 12:123429536-123429558 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1103977923 12:124715713-124715735 CGCCCAGCCGGGCCCTGCAATGG - Intergenic
1104065207 12:125300027-125300049 CGCCCTGCGTGGGCCGCCACGGG + Intronic
1104383035 12:128324614-128324636 CGTCCCGCCTCGGCCTCCCAAGG - Intronic
1104860839 12:131922592-131922614 AACCCCGCCTGGGCCTCCCTTGG + Exonic
1104927651 12:132321966-132321988 GCCCCCGCCTCGGCCCCCAAGGG + Intronic
1104999701 12:132682050-132682072 CCGCCCGCCTCGGCCTCCCACGG - Intronic
1105228631 13:18465184-18465206 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1105355576 13:19656514-19656536 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1105533420 13:21241586-21241608 CCTCCTGCCTAGGCCTCCAAAGG + Intergenic
1106155872 13:27155322-27155344 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1106205561 13:27590460-27590482 CTGCCCGCCTCGGCCTCCCACGG + Intronic
1106330337 13:28733691-28733713 CCCCTCACCTTGGCCTCCAAAGG + Intergenic
1106747819 13:32722109-32722131 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1106872194 13:34033851-34033873 CCGCCCGCCTTGGCCTCCCAAGG + Intergenic
1106952216 13:34897061-34897083 CAGCCTGCCTCGGCCTCCAAAGG - Intergenic
1107147786 13:37078001-37078023 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1107463657 13:40629383-40629405 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1107529279 13:41266366-41266388 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1107954431 13:45496914-45496936 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1108073774 13:46657770-46657792 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1108362856 13:49683281-49683303 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1108614388 13:52117160-52117182 CTGCCCGCCTCGGCCTCCCAGGG + Intronic
1108751902 13:53456327-53456349 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1108910456 13:55544588-55544610 CAGCCCGCCTTGGCCTCCAGAGG - Intergenic
1109648412 13:65291781-65291803 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1109919472 13:69036800-69036822 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1110070740 13:71174075-71174097 CGCCACGCCCGGCCCTCCAGTGG - Intergenic
1110288540 13:73777886-73777908 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1110319755 13:74148156-74148178 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1110567623 13:76972149-76972171 CCCCCGGCCTCGGCCTCCCAGGG - Intergenic
1112469647 13:99676097-99676119 CTGCCCGCCTCGGCCTCCCATGG + Intronic
1112768566 13:102772808-102772830 CCACCCGCCTCGGCCTCCCATGG + Intronic
1113329006 13:109311141-109311163 CTGCCCGCCTGGGCCTCCCGAGG + Intergenic
1113636345 13:111921475-111921497 CGCCCCACCTGGCTCTCCACTGG - Intergenic
1114175618 14:20317165-20317187 CCGCCCGCCTTGGCCTCCTAAGG - Intronic
1114322548 14:21559310-21559332 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1114508566 14:23237371-23237393 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1114624839 14:24122211-24122233 CTGCCCGCCTCGGCCTCCCACGG - Intronic
1114695857 14:24627174-24627196 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1115361153 14:32504521-32504543 CTCCCCACCTCGGCCTCCCAGGG + Intronic
1115549927 14:34495798-34495820 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1115555523 14:34542378-34542400 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
1115558385 14:34560715-34560737 CCGCCCGCCTTGGCCTCCCAAGG + Intergenic
1115559731 14:34572313-34572335 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1115629547 14:35230293-35230315 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1116080812 14:40168730-40168752 CGCCCCACCTGGGCCTCGCTTGG - Intergenic
1116924474 14:50620014-50620036 CCTCCCGCCTCGGCCTCCCAAGG - Intronic
1117124932 14:52613001-52613023 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1117130874 14:52685966-52685988 CCTCCCGCCTTGGCCTCCCAGGG - Intronic
1117298929 14:54404821-54404843 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1117537668 14:56717530-56717552 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1117689647 14:58293478-58293500 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1118369924 14:65129260-65129282 CCACCCGCCTCGGCCTCCCAGGG + Intergenic
1118579782 14:67284352-67284374 CCTCCTGCCTTGGCCTCCAAAGG - Intronic
1119280943 14:73407084-73407106 CCACCCACCTGGGCCTCCCAAGG + Intronic
1119677358 14:76565882-76565904 CCTCCCACCTCGGCCTCCAAAGG - Intergenic
1119983678 14:79111493-79111515 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1120027628 14:79604132-79604154 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1120148607 14:81006754-81006776 CTCCCCGCCTCGGTCTCCCAAGG + Intronic
1120525354 14:85570826-85570848 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1120955053 14:90074209-90074231 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1122427093 14:101617223-101617245 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1122614169 14:103005462-103005484 CCTCCCGCCTTGGCCTCCCAAGG - Intronic
1122615113 14:103011870-103011892 CTCCCCGCCTCGGCCTCCCAAGG - Intronic
1122995175 14:105259664-105259686 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
1123000541 14:105291752-105291774 CCACCCGCCTTGGCCTCCGAAGG - Intronic
1123200021 14:106654007-106654029 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1123587644 15:21773388-21773410 CCCCCCACCTGGGCCTCCCAAGG - Intergenic
1123624282 15:22215953-22215975 CCCCCCACCTGGGCCTCCCAAGG - Intergenic
1123734915 15:23175871-23175893 CCGCCCGCCTCGGCCTCCCAGGG - Intergenic
1123950095 15:25262928-25262950 CACTCCGCCTTGGCCTCCTAAGG - Intergenic
1124169351 15:27358963-27358985 CGCCCCGCCGGGTCCTCCCCAGG - Intronic
1124285420 15:28397175-28397197 CCGCCCGCCTCGGCCTCCCAGGG - Intergenic
1124297277 15:28514467-28514489 CCGCCCGCCTCGGCCTCCCAGGG + Intergenic
1124564987 15:30804354-30804376 CTGCCCGCCTCGGCCTCCAGGGG - Intergenic
1124922036 15:34036864-34036886 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1124930917 15:34118537-34118559 CAGCCCGCCTTGGCCTCCCAAGG + Intergenic
1125139281 15:36385333-36385355 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1125650864 15:41316544-41316566 CCGCCCGCCTTGGCCTCCTAAGG - Intronic
1125699645 15:41670747-41670769 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1126032334 15:44511623-44511645 CTCCCCGCCTCGGCCTCCCAGGG - Intronic
1126040691 15:44587444-44587466 CCTCCCGCCTTGGCCTCCCATGG - Intronic
1127449281 15:59101147-59101169 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1127453993 15:59141553-59141575 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1127456540 15:59160660-59160682 CGTCCGGCCTTGGCCTCCCAAGG + Intronic
1127479202 15:59363218-59363240 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1127589604 15:60410350-60410372 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1127904618 15:63367162-63367184 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1127962897 15:63902981-63903003 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1128156636 15:65395702-65395724 CGCCCCGCCCGGGCCTGCGCTGG + Intronic
1128422573 15:67507821-67507843 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1128435992 15:67648820-67648842 CTCCCCGCCTTGGCCTCCCGAGG + Intronic
1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG + Intronic
1128653742 15:69442003-69442025 CCTCCTGCCTTGGCCTCCAAAGG + Intronic
1129425885 15:75462511-75462533 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1129488743 15:75903510-75903532 ACTCCCGCCTGGGCCTCCCAAGG - Intergenic
1130367755 15:83255562-83255584 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
1130965263 15:88692975-88692997 CTGACCGCCTCGGCCTCCAAAGG + Intergenic
1131475877 15:92738845-92738867 CCGCCCGCCTTGGCCTCCCAAGG + Intronic
1131962992 15:97808625-97808647 CCTCCCGCCTTGGCCTCCCAAGG - Intergenic
1132369140 15:101281158-101281180 CCTCCCGCCTTGGCCTCCCAAGG - Intergenic
1132508828 16:326503-326525 CCGCCCGCCTTGGCCTCCCATGG - Intronic
1132698455 16:1212251-1212273 CGCCTTGCCTGGGCCTGCATGGG + Intronic
1132741758 16:1417358-1417380 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1132884899 16:2178367-2178389 CGCCTGGCCGGGGGCTCCAAGGG - Exonic
1132927505 16:2438751-2438773 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1132942157 16:2513768-2513790 CGCCCTGCCTCGGCCTCCGCGGG - Intronic
1133065462 16:3203520-3203542 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
1133092503 16:3415191-3415213 CTACCCGCCTTGGCCTCCCAAGG + Intronic
1133228678 16:4355710-4355732 CCGCCCGCCTCGGCCTCCCACGG + Intronic
1133831219 16:9325426-9325448 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
1134240832 16:12505024-12505046 CGTCCCGTCTTGGCCTCCCAAGG - Intronic
1134271496 16:12736944-12736966 CCACCCACCTGGGCCTCCCAAGG - Intronic
1134630939 16:15755687-15755709 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1134750263 16:16619594-16619616 CTGCCCGCCTGGGCCTCCCAAGG - Intergenic
1134995195 16:18734004-18734026 CTGCCCGCCTGGGCCTCCCGAGG + Intergenic
1135029735 16:19028895-19028917 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1135091330 16:19520478-19520500 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1135329122 16:21546482-21546504 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
1135683315 16:24477560-24477582 CCTCCCTCCTGGGCCTCCCAAGG + Intergenic
1136153235 16:28365649-28365671 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1136175651 16:28514535-28514557 CGACACGCCTGGTCCTCCAGTGG + Intergenic
1136209851 16:28749624-28749646 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1136339463 16:29632426-29632448 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
1136378081 16:29877151-29877173 CCTCCCGCCTCGGCCTCCCAAGG + Intronic
1136465376 16:30439526-30439548 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1136474998 16:30507214-30507236 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1137871282 16:51952952-51952974 CCACCCGCCTCAGCCTCCAAGGG + Intergenic
1138004753 16:53322362-53322384 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1138013935 16:53412483-53412505 CCGCCCGCCTCGGCCTCCCAGGG + Intergenic
1138151316 16:54659926-54659948 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1138443759 16:57050446-57050468 CCCCTCTCCGGGGCCTCCAAGGG - Intronic
1138669038 16:58598018-58598040 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
1139315089 16:66060979-66061001 CCTCCCGCCTTGGCCTCCCAAGG - Intergenic
1139416960 16:66820512-66820534 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1139610452 16:68053202-68053224 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1139613218 16:68073690-68073712 CCGCCCGCCTTGGCCTCCCAAGG + Intronic
1139909226 16:70386885-70386907 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1139946147 16:70643616-70643638 CCCCCGGCCTTGGCCTCCCAAGG + Intronic
1140279689 16:73543460-73543482 GGCCCTGCCGGTGCCTCCAAAGG - Intergenic
1140356439 16:74310869-74310891 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1140395000 16:74618778-74618800 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1140501737 16:75439236-75439258 CCGCCCGCCTCGGCCTCCCAGGG + Intronic
1140753362 16:78046067-78046089 CGCCCTGCCAGGGCCGCCGAGGG - Intronic
1140878235 16:79173219-79173241 CTCCCCTCCTGGGCCTCCTGAGG + Intronic
1141012643 16:80417240-80417262 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1141197899 16:81875205-81875227 CCTCCCGCCTTGGCCTCCCAAGG + Intronic
1141320159 16:83000820-83000842 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1141370947 16:83485897-83485919 CCACCTGCCTCGGCCTCCAAGGG - Intronic
1141532010 16:84652972-84652994 CCTCCCGCCTCGGCCTCCCAGGG - Intronic
1141668400 16:85478281-85478303 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1142219218 16:88845102-88845124 CCGCCCGCCTCGGCCTCCCACGG - Intronic
1142580189 17:937225-937247 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1142582995 17:953169-953191 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1142683468 17:1563127-1563149 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1142895411 17:2974096-2974118 CCGCCCGCCTTGGCCTCCCAAGG - Intronic
1143019443 17:3909271-3909293 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1143036063 17:3999409-3999431 CCCCCCGCCTCGGCCTCCCAAGG - Intergenic
1143123599 17:4625999-4626021 CCTCCCGCCTCGGCCTCCCAGGG + Intergenic
1143322516 17:6077328-6077350 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1143536108 17:7540998-7541020 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1143654242 17:8284220-8284242 CCTCCCTCCTGGGCCTCCTACGG + Intergenic
1143689926 17:8552831-8552853 CACCCTGCCTGGGCTTCCCAGGG + Intronic
1143705323 17:8693676-8693698 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1143745292 17:8989444-8989466 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1143950121 17:10625753-10625775 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1144020724 17:11239034-11239056 CACCCAGCCTAGGCCTGCAAGGG - Intergenic
1144079769 17:11753419-11753441 CTGCCCGCCTTGGCCTCCCAGGG - Intronic
1144559428 17:16309517-16309539 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1144691822 17:17271574-17271596 CCTCCCGCCTTGGCCTCCCAAGG - Intronic
1144699738 17:17329219-17329241 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1145158295 17:20557197-20557219 CTGCCCGCCTGGGCCTCCTGAGG + Intergenic
1145719530 17:27057164-27057186 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1145946013 17:28775224-28775246 CTCCCCACCTCGGCCTCCCAAGG + Intronic
1146085198 17:29821885-29821907 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1146190329 17:30759953-30759975 CTACCCGCCTTGGCCTCCCAAGG + Intergenic
1146306623 17:31734752-31734774 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1146315619 17:31804775-31804797 CGCCCAACCTCGGCCTCCCAAGG - Intergenic
1146335500 17:31966587-31966609 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1146356577 17:32139561-32139583 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1146367459 17:32240048-32240070 CCACCTGCCTCGGCCTCCAAAGG - Intronic
1146375532 17:32291436-32291458 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1147191913 17:38742800-38742822 CGTGCCATCTGGGCCTCCAAAGG + Intronic
1147244560 17:39111526-39111548 CCACCCACCTGGGCCTCCCAAGG + Intronic
1147300348 17:39521504-39521526 CCGCCCGCCTTGGCCTCCCAAGG + Intronic
1147409175 17:40236848-40236870 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1147584020 17:41642642-41642664 CTCCCTCCCTGGGCCTCCCAAGG - Intergenic
1147975563 17:44246372-44246394 CCATCCGCCTGGGCCTCCCACGG - Intergenic
1148048045 17:44756007-44756029 CCACCCGCCTCGGCCTCCCAGGG - Intergenic
1148281283 17:46349530-46349552 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1148303511 17:46567465-46567487 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1148494699 17:48046517-48046539 CCTCCCGCCTCGGCCTCCCAAGG + Intergenic
1148499086 17:48075434-48075456 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1148888179 17:50788620-50788642 CCGCCCGCCTTGGCCTCCCAAGG + Intergenic
1149308179 17:55369365-55369387 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1149603212 17:57906725-57906747 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1149630862 17:58121756-58121778 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
1149636358 17:58173259-58173281 CAACCCGCCTCGGCCTCCCAAGG + Intergenic
1149743151 17:59067777-59067799 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1149788754 17:59458955-59458977 CCTCCCGCCTCGGCCTCCCAAGG - Intergenic
1150203329 17:63379424-63379446 CCACCTGCCTTGGCCTCCAAAGG - Intronic
1150242286 17:63644457-63644479 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1150255074 17:63738097-63738119 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1150261578 17:63796557-63796579 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1150311032 17:64129820-64129842 CGCCCGGCCCGAGCCTCCCACGG + Intronic
1150470024 17:65429328-65429350 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1150558313 17:66273658-66273680 CCCCCTGCCTTGGCCTCCCAAGG - Intergenic
1150679478 17:67273028-67273050 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1151154054 17:72112104-72112126 CCTCCTGCCTGGGCCTCCCAAGG - Intergenic
1151262175 17:72924758-72924780 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1151582264 17:74987269-74987291 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
1151629928 17:75303577-75303599 CTCCCCGCCTCGGCCTCCCACGG + Intergenic
1151670842 17:75570941-75570963 CTCCCCTCCTGTGCCTGCAAGGG - Exonic
1151671576 17:75574165-75574187 CGCCCCGCCTGGGCCCTCCTCGG - Intronic
1151723443 17:75871482-75871504 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1151798445 17:76362652-76362674 CCTCCCGCCTTGGCCTCCCAAGG - Intronic
1151827248 17:76530253-76530275 CGGCCTCCCTGGGCCCCCAAGGG - Intronic
1152150146 17:78594233-78594255 CCGCCCGCCTAGGCCTCCCAAGG + Intergenic
1152347279 17:79760837-79760859 CTCCTGGCCTGGCCCTCCAAGGG - Intergenic
1152368991 17:79873560-79873582 CCTCCCGCCTCGGCCTCCCAGGG + Intergenic
1152674067 17:81627967-81627989 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
1152726558 17:81949632-81949654 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1152816226 17:82409651-82409673 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1152898745 17:82928230-82928252 TCCCCAGCCTGGGCCTCCAACGG + Intronic
1152941288 17:83174006-83174028 CGCCTCGTCGGGGCCTCCAGGGG - Intergenic
1152950244 17:83225822-83225844 CCTCCCACCTGGGCCTCCAAAGG - Intergenic
1153032627 18:729259-729281 CACCCCGCCTGGCCCTCAAATGG - Intronic
1153613268 18:6909534-6909556 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1154042444 18:10870117-10870139 CTGCCCACCTGGGCCTCCCAAGG + Intronic
1154073527 18:11177374-11177396 CTGCCCGCCTTGGCCTCCCAGGG + Intergenic
1154305291 18:13226262-13226284 CTTCCCGCCTTGGCCTCCCAGGG + Intronic
1154950283 18:21203099-21203121 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1154954224 18:21239881-21239903 CCACCTGCCTTGGCCTCCAAAGG + Intergenic
1155002108 18:21697622-21697644 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1155144118 18:23069366-23069388 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1155394643 18:25374524-25374546 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1155447437 18:25927074-25927096 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1155951230 18:31915516-31915538 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1157455780 18:47827723-47827745 CTGCCCGCCTGGGCCTCCCGAGG + Exonic
1158088959 18:53687764-53687786 CAGCCCGCCTTGGCCTCCCAAGG - Intergenic
1158482883 18:57837377-57837399 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1159200143 18:65173243-65173265 CCACCCGCCTAGGCCTCCCAAGG - Intergenic
1159330817 18:66991940-66991962 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
1159349114 18:67248797-67248819 CTGCCCGCCTTGGCCTCCCATGG + Intergenic
1159658211 18:71058172-71058194 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1160338471 18:78065066-78065088 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1160474686 18:79172216-79172238 CGATCCGCCTTGGCCTCCCAAGG + Intronic
1160474701 18:79172278-79172300 CGATCCGCCTTGGCCTCCCAAGG + Intronic
1160474716 18:79172340-79172362 CGATCCGCCTTGGCCTCCCAAGG + Intronic
1160474731 18:79172402-79172424 CGATCCGCCTTGGCCTCCCAAGG + Intronic
1160474747 18:79172464-79172486 CGATCCGCCTTGGCCTCCCAAGG + Intronic
1160474762 18:79172527-79172549 CGATCCGCCTTGGCCTCCCAAGG + Intronic
1160474774 18:79172589-79172611 CGATCCGCCTTGGCCTCCCAAGG + Intronic
1160656988 19:278085-278107 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1160697234 19:490853-490875 CCGCCCGCCTTGGCCTCCCAAGG - Intronic
1160751870 19:738145-738167 CTGCCCGCCTTGGCCTCCAAAGG - Intronic
1160830901 19:1104496-1104518 CGCCCCGCCGTGGCCCTCAACGG - Intronic
1160874699 19:1291562-1291584 CGGCCAGCCTGGGCCTCCCCGGG + Intronic
1160995816 19:1881576-1881598 CGCCCAGGCCGGGCCTCCACCGG + Exonic
1161133669 19:2606975-2606997 CCCCCCGCCTCGGCCTCCTGAGG - Intronic
1161214058 19:3084475-3084497 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1161285453 19:3466100-3466122 ACCCTCGGCTGGGCCTCCAATGG - Intronic
1161312040 19:3600174-3600196 CGCCGCGCCTGGGCCACCGTGGG - Exonic
1161359012 19:3835699-3835721 CCTCCCGCCTTGGCCTCCCAAGG - Intronic
1161547687 19:4891711-4891733 CCTCCCGCCTCGGCCTCCCAAGG - Intronic
1161739162 19:6009807-6009829 CCTCCCGCCTTGGCCTCCCAAGG + Intronic
1161919079 19:7252870-7252892 CTGCCCGCCTTGGCCTCCCAGGG - Intronic
1162122421 19:8479685-8479707 CCTCCCGCCTTGGCCTCCCAAGG + Intronic
1162339346 19:10082696-10082718 CGCCCAGCTTAAGCCTCCAAGGG + Intergenic
1162405430 19:10470198-10470220 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1162447358 19:10731595-10731617 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1162492540 19:11002234-11002256 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1162581867 19:11536218-11536240 CGCCCCTCCCGGGCCGCCAGGGG + Intergenic
1162603800 19:11691753-11691775 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1162777178 19:12986877-12986899 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1162780420 19:13004016-13004038 CCTCCCGCCTCGGCCTCCCAAGG + Intronic
1162932278 19:13963085-13963107 CGCCCCGCCCGCGCCCCCAGTGG + Intronic
1162998008 19:14348631-14348653 CGCCACCTGTGGGCCTCCAAGGG + Intergenic
1163029396 19:14534365-14534387 CCGCCCGCCTCGGCCTCCCAGGG + Intronic
1163092573 19:15031122-15031144 CCTCCCGCCTTGGCCTCCCAAGG + Intergenic
1163462844 19:17448938-17448960 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1163495368 19:17643560-17643582 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1163553090 19:17976659-17976681 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1163576475 19:18113839-18113861 CCACCCGCCTTGGCCTCCCACGG + Intronic
1163590647 19:18192402-18192424 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1163904207 19:20137521-20137543 CCGCCAGCCTGGGCCTCCCAAGG + Intergenic
1163918070 19:20260282-20260304 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1164002825 19:21120281-21120303 CCACCCACCTTGGCCTCCAAAGG + Exonic
1164012867 19:21222783-21222805 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
1164231312 19:23290562-23290584 CTGCCCGCCTGGGCCTCCCCGGG - Intergenic
1164606824 19:29605612-29605634 CCTCCCGCCTGCGCCTCCCACGG + Exonic
1164994030 19:32706438-32706460 CTGCCCGCCTCGGCCCCCAAGGG - Intronic
1165023936 19:32945744-32945766 CTTCCCGCCTTGGCCTCCCAAGG + Intronic
1165524142 19:36338440-36338462 CCTCCCTCCTTGGCCTCCAAAGG - Exonic
1165568750 19:36756855-36756877 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1165645739 19:37434443-37434465 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1165777739 19:38414808-38414830 CGCCCAGGCTGGGCTTCCAAGGG - Intronic
1166042546 19:40212696-40212718 CCCTCCGCCTGGGAGTCCAAGGG - Intronic
1166152773 19:40886186-40886208 CCGCCCGCCTGGGACTCCCAAGG + Intronic
1166189919 19:41169728-41169750 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1166762684 19:45234707-45234729 CGGCGCGCCTGGGCCTCCCAAGG - Intronic
1166789318 19:45388979-45389001 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1166817100 19:45552917-45552939 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1166985165 19:46655366-46655388 CTCCCTGCCTTGGCCTCCCAAGG - Intronic
1167071220 19:47223025-47223047 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1167076937 19:47256095-47256117 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1167138971 19:47636450-47636472 CCTCCTGCCTGGGCCTCCCAAGG + Intronic
1167192898 19:48004185-48004207 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1167242472 19:48352529-48352551 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1167259854 19:48452339-48452361 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1167328375 19:48838518-48838540 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1167588828 19:50391450-50391472 CTGCCCGCCTGGGCCTCCCGAGG - Intronic
1167728580 19:51235913-51235935 CCGCCCGCCTTGGCCTCCAAAGG - Intronic
1167801937 19:51748971-51748993 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1167969715 19:53181174-53181196 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1168154696 19:54466197-54466219 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1168393854 19:56032099-56032121 GCCCCCGCCTTGGCCTCCTAAGG - Intronic
1168506510 19:56939643-56939665 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
925417700 2:3682766-3682788 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
925450723 2:3967333-3967355 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
925731587 2:6922865-6922887 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
925830794 2:7893556-7893578 CTTCCCGCCTTGGCCTCCCAAGG + Intergenic
926065186 2:9833134-9833156 CCTCCCGCCTCGGCCTCCCAAGG - Intergenic
926133096 2:10317785-10317807 CGCCAGGGCAGGGCCTCCAATGG - Intronic
926276244 2:11405241-11405263 CTGCCCGCCTTGGCCTCCCAGGG - Intergenic
927499978 2:23576059-23576081 CCACCCGCCTCGGCCTCCCAAGG - Intronic
927640302 2:24841523-24841545 GGCCCCGCCTGGCTCTCCAGCGG - Intronic
927752036 2:25677844-25677866 CCACCCGCCTCAGCCTCCAAAGG + Intergenic
928259046 2:29750417-29750439 CCTCCCACCTTGGCCTCCAAAGG - Intronic
928502627 2:31913033-31913055 CCGCCCGCCTTGGCCTCCCAAGG - Intronic
928597845 2:32873232-32873254 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
928615744 2:33037960-33037982 CCCCCTGCCTTGGCCTCCCAAGG + Intronic
928873506 2:36010265-36010287 CCTCCCACCTGGGCCTCCCAGGG - Intergenic
928884153 2:36129426-36129448 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
928915528 2:36466127-36466149 CCACCCGCCTCGGCCTCCCAAGG + Intronic
929665956 2:43833925-43833947 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
929730013 2:44478940-44478962 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
929892899 2:45933717-45933739 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
930074682 2:47397017-47397039 CCACCCGCCTCGGCCTCCCAGGG - Intergenic
930365943 2:50439561-50439583 CCACCCGCCTCGGCCTCCCAGGG - Intronic
930415870 2:51090727-51090749 CCTCCCGCCTTGGCCTCCCAAGG + Intergenic
930645799 2:53905455-53905477 CTGCCTGCCTGGGCCTCCCATGG - Intronic
930688099 2:54330660-54330682 CACCCCTCCTGGCCCTACAATGG + Intronic
931794745 2:65698642-65698664 CTGCCCACCTGGGCCTCCCAAGG + Intergenic
932059821 2:68484751-68484773 CTGCCCACCTGGGCCTCCCAAGG - Intronic
932548436 2:72740857-72740879 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
932671010 2:73737954-73737976 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
932926770 2:75985176-75985198 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
933403621 2:81830435-81830457 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
933707350 2:85301880-85301902 CCACCCGCCTCGGCCTCCCAAGG - Intronic
933842076 2:86295780-86295802 CCGCCCGCCTTGGCCTCCCAAGG + Intronic
933985294 2:87585990-87586012 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
934069807 2:88373599-88373621 CCACCCGCCTCGGCCTCCAAAGG - Intergenic
934745778 2:96758726-96758748 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
934932932 2:98443164-98443186 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
935698390 2:105789430-105789452 CCACCCGCCTCGGCCTCCCAAGG + Intronic
936072540 2:109380871-109380893 TGCCCTGCTGGGGCCTCCAAAGG - Intronic
936103288 2:109602430-109602452 CCACCCGCCTTGGCCTCCCAAGG - Intronic
936308550 2:111364817-111364839 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
936451825 2:112639511-112639533 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
936574193 2:113639908-113639930 CCTCCCACCTGGGCCTCTAAAGG - Intronic
936708393 2:115102650-115102672 CCACCCGCCTCGGCCTCCCAAGG + Intronic
936871495 2:117138292-117138314 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
937192790 2:120120870-120120892 CTGCCCGCCTCGGCCTCCCAGGG - Intronic
937194964 2:120145699-120145721 CCACCTGCCTGGGCCTCCCAAGG - Intronic
937322396 2:120968741-120968763 CGCCCCGCCTGAGCCGCAAGCGG + Exonic
937329556 2:121018250-121018272 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
937433672 2:121862312-121862334 CCTCCCACCTGGGCCTCCCAAGG - Intergenic
937573027 2:123386924-123386946 CCACCCACCTCGGCCTCCAAAGG - Intergenic
937851514 2:126640217-126640239 CCCCCAGCCTGGGGCTGCAATGG + Intergenic
938253315 2:129833263-129833285 CTGCCCGCCTGGGCCTCCCGAGG + Intergenic
938342510 2:130544853-130544875 CTGCCCTCCTCGGCCTCCAAGGG - Intronic
938347322 2:130575856-130575878 CTGCCCTCCTCGGCCTCCAAGGG + Intronic
938532182 2:132199106-132199128 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
938739591 2:134218649-134218671 GTCCCAACCTGGGCCTCCAAAGG - Intronic
938837994 2:135127583-135127605 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
938961429 2:136345053-136345075 CCCCCCACCTCGGCCTCCCAAGG - Intergenic
938968366 2:136408204-136408226 CGCCCTCCCTGGGCCTCTACTGG + Intergenic
939065086 2:137473449-137473471 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
939684012 2:145175119-145175141 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
939958675 2:148547421-148547443 CGCCCCACCTCCGCCTCCCAAGG - Intergenic
940464386 2:154009731-154009753 CCACCCGCCTCGGCCTCCCAAGG + Intronic
940510049 2:154602336-154602358 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
941348050 2:164394456-164394478 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
941603301 2:167564491-167564513 CGTCCTGCCTTGGCCTCCCAGGG - Intergenic
941732379 2:168932864-168932886 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
942037997 2:172029997-172030019 CCACCCGCCTGGGCCTCCCAAGG + Intronic
942242058 2:173971885-173971907 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
942559866 2:177209050-177209072 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
943338121 2:186644185-186644207 CTGCCTGCCTCGGCCTCCAAAGG + Intronic
944232785 2:197412739-197412761 CCACCCGCCTTGGCCTCCCAAGG - Intronic
944248091 2:197553774-197553796 CTGCCCACCTTGGCCTCCAAAGG - Intergenic
944825125 2:203475162-203475184 CCTCCCGCCTCGGCCTCCCAAGG - Intronic
945148803 2:206766014-206766036 CCACCCGCCTCGGCCTCCCAAGG - Intronic
946870843 2:224083363-224083385 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
947388402 2:229615464-229615486 CCACCCGCCTCGGCCTCCCAAGG - Intronic
947504627 2:230698166-230698188 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
947864805 2:233389106-233389128 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
948121951 2:235537280-235537302 CTCCCCACCTGGGCCTGCAGCGG - Intronic
1169171542 20:3469790-3469812 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1169467829 20:5857217-5857239 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1170374336 20:15683821-15683843 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1171976494 20:31598062-31598084 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1172005396 20:31815943-31815965 CCCCACCCCTGTGCCTCCAAGGG + Intergenic
1172293129 20:33790314-33790336 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1172423383 20:34836690-34836712 CCACCCGCCTCAGCCTCCAAAGG - Intergenic
1172536562 20:35678104-35678126 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1172719604 20:36989605-36989627 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1173039738 20:39451113-39451135 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
1173335610 20:42110291-42110313 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1173630084 20:44506348-44506370 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1174011374 20:47452376-47452398 CCGCCCGCCTTGGCCTCCCAAGG + Intergenic
1174042559 20:47710279-47710301 CCTCCCGCCTTGGCCTCCCAAGG + Intronic
1174096883 20:48096783-48096805 CTGCCCGCCTCGGCCTCCCAGGG - Intergenic
1174247319 20:49191268-49191290 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1174372703 20:50103647-50103669 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1174381999 20:50161992-50162014 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1174811539 20:53649773-53649795 CCACCCGCCTGGGCCTTCCAAGG + Intergenic
1175404270 20:58716683-58716705 AGCCCCGGCTGGGCCTGAAAAGG + Intronic
1175883075 20:62271693-62271715 CCACCCGCCTCGGCCTCCCAGGG + Intronic
1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG + Intronic
1176164108 20:63663932-63663954 CGCCCACCCTGTCCCTCCAAGGG - Intronic
1176186502 20:63782857-63782879 CCTCCCGCCTGGGCCTCCCATGG - Intronic
1176213520 20:63937600-63937622 CCGCCCGCCTCGGCCTCCCAGGG + Intergenic
1176264679 20:64203008-64203030 GACCCAGCCAGGGCCTCCAAGGG - Intronic
1176281502 20:64316402-64316424 CGGCCCTCCTCGGCCTCCACGGG - Intergenic
1176331935 21:5557154-5557176 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1176395822 21:6263797-6263819 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1176411434 21:6451409-6451431 AGCCAGGCCTGGCCCTCCAAGGG + Intergenic
1176441335 21:6725307-6725329 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1176465597 21:7052376-7052398 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1176489158 21:7434154-7434176 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1176737058 21:10559628-10559650 CCGCCCGCCTCGGCCTCCCAGGG - Intronic
1176772608 21:13093369-13093391 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1177152732 21:17470779-17470801 CCGCCCGCCTCGGCCTCCAAAGG - Intergenic
1177333222 21:19688189-19688211 CCACCCGCCTCGGCCTCCTAGGG + Intergenic
1177565402 21:22814965-22814987 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1177960222 21:27655562-27655584 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1178397964 21:32259308-32259330 TGCCTCGCCTTGGCCTCCCAGGG + Intergenic
1178457138 21:32765889-32765911 CCACCCGCCTTGGCCTCCCAGGG - Intronic
1178802822 21:35811892-35811914 CTGCCCGCCTTGGCCTCCCAGGG - Intronic
1179419631 21:41224989-41225011 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1179467999 21:41590684-41590706 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1179686927 21:43059731-43059753 AGCCAGGCCTGGCCCTCCAAGGG + Intronic
1180511468 22:16095195-16095217 CTGCCCGCCTCGGCCTCCCATGG + Intergenic
1180556668 22:16583823-16583845 CCACCCGCCTGGGCCTTCGAAGG - Intergenic
1180949548 22:19714940-19714962 CGCCGCGCCTGGGGCTTCAGAGG + Intronic
1180951816 22:19723845-19723867 CGCCCCGCGCGGCCCTGCAAGGG - Exonic
1181334558 22:22118015-22118037 CGCCCGGGCCGGGCCTCCACCGG + Intergenic
1181530790 22:23516210-23516232 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1181749282 22:24977571-24977593 AGCCCACCCTGGGGCTCCAAAGG + Intronic
1181764660 22:25082587-25082609 CCTCCCACCTGGGCCTCCCAAGG - Intronic
1182094002 22:27614225-27614247 CGCCCCCCCCCGGTCTCCAAGGG - Intergenic
1182139153 22:27937829-27937851 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1182302257 22:29343544-29343566 AGCCCTGCCTGGGCAGCCAATGG + Intronic
1182313455 22:29426077-29426099 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
1182854429 22:33504501-33504523 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1183165565 22:36144764-36144786 CCTCCCGCCTCGGCCTCCCAAGG - Intronic
1183468817 22:37994747-37994769 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1183577681 22:38702122-38702144 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1183612633 22:38920799-38920821 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1183695128 22:39417375-39417397 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1183897074 22:40977945-40977967 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1183898051 22:40984724-40984746 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1184006289 22:41711956-41711978 CCGCCCGCCTTGGCCTCCCAGGG - Intronic
1184204065 22:42989551-42989573 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1184288399 22:43484761-43484783 AGCCCCGCCTGAGCCTCTCAGGG + Intronic
1184304192 22:43584320-43584342 CTGCCAGCCTGTGCCTCCAAAGG - Intronic
1184422411 22:44389672-44389694 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1184568036 22:45304812-45304834 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1184727787 22:46356579-46356601 GGCCTCTCCTGGGACTCCAAGGG - Intronic
1185014067 22:48333309-48333331 CGCCACGCCCAGGCCTCCCATGG + Intergenic
1185341249 22:50292092-50292114 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1185425980 22:50770983-50771005 CCTCCCACCTGGGCCTCTAAAGG + Intronic
949089772 3:13126-13148 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
949091990 3:39474-39496 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
949274110 3:2257818-2257840 CGGCCCACCTCGGCCTCCCAAGG - Intronic
949338786 3:3006117-3006139 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
949628317 3:5893147-5893169 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
950441450 3:13013202-13013224 CCGCCCGCCTTGGCCTCCCAAGG + Intronic
950526117 3:13524674-13524696 CCACCTGCCTGGGCCTCCCAAGG - Intergenic
950707833 3:14793890-14793912 AGACCCCCCTGGGCCTCCCAGGG - Intergenic
950745659 3:15086152-15086174 CTTCCCGCCTTGGCCTCCCAAGG - Intronic
950999432 3:17540663-17540685 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
952326091 3:32321840-32321862 CCACCCGCCTTGGCCTCCCAAGG + Intronic
952972476 3:38660644-38660666 CCACCCGCCTTGGCCTCCCAGGG + Intergenic
953943544 3:47125073-47125095 CCTCCCGCCTCGGCCTCCCAAGG - Intronic
954024015 3:47767624-47767646 CCACCCGCCTCGGCCTCCCAAGG - Intronic
954038124 3:47864197-47864219 CCTCCTGCCTGGGCCTCCCAGGG + Intronic
954039776 3:47876372-47876394 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
954077777 3:48193911-48193933 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
954228231 3:49196911-49196933 CTGCCCGCCTCGGCCTCCCAGGG + Intergenic
954618367 3:51981980-51982002 CCACCCGCCTTGGCCTCCCAAGG - Intronic
954742439 3:52764386-52764408 CCACCCGCCTCGGCCTCCCAAGG - Intronic
954818263 3:53301514-53301536 CCACCCGCCTTGGCCTCCCAAGG + Intronic
955188893 3:56741744-56741766 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
955283366 3:57615558-57615580 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
955363878 3:58295606-58295628 CCTCCCGCCTTGGCCTCCCAAGG - Intronic
955703909 3:61708698-61708720 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
955922604 3:63973572-63973594 CGCCCTGCTTGGGCCTCCCTCGG + Intronic
956187358 3:66575357-66575379 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
956826653 3:73003457-73003479 CCCCCTGCCTTTGCCTCCAAAGG + Intronic
957389593 3:79546936-79546958 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
957644958 3:82909272-82909294 CTCCCTGCCTCGGCCTCCCAAGG - Intergenic
958447906 3:94237659-94237681 CCGCCCGCCTTGGCCTCCCAAGG + Intergenic
958449887 3:94259909-94259931 TGCCCCACCTGGGCCTCACACGG - Intergenic
959378117 3:105609674-105609696 CCACCCGCCTGGGCCACCCAAGG - Intergenic
959588554 3:108050357-108050379 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
960724320 3:120654827-120654849 CCACCCACCTTGGCCTCCAAAGG - Intronic
960951540 3:123001684-123001706 CGCCAGGCCTGGGCTTTCAAGGG - Intronic
960963005 3:123085086-123085108 CGACCCTTCTGGGCCTCCCAAGG + Intronic
961185874 3:124914681-124914703 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
961630257 3:128293416-128293438 CTACCCGCCTTGGCCTCCCAAGG - Intronic
961699598 3:128732279-128732301 CCGCCCGCCTTGGCCTCCCAAGG + Intronic
962220149 3:133558160-133558182 CTACCTGCCTTGGCCTCCAAAGG + Intergenic
962352984 3:134669269-134669291 CTGCCCACCTCGGCCTCCAAAGG + Intronic
962561141 3:136608011-136608033 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
962574859 3:136747443-136747465 CAGCCCGCCTTGGCCTCCCAAGG - Intronic
962788456 3:138789213-138789235 CTGCCTGCCTTGGCCTCCAAAGG - Intronic
962801034 3:138890738-138890760 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
962806782 3:138933169-138933191 CACCCTGCCTGGGTCTCCAGGGG + Intergenic
963212967 3:142714922-142714944 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
964002251 3:151789026-151789048 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
964129078 3:153267559-153267581 CTTCCCGCCTTGGCCTCCCAAGG - Intergenic
964324307 3:155530008-155530030 CCACCCGCCTTGGCCTCCCAAGG + Intronic
964806994 3:160621082-160621104 CCTCCCGCCTTGGCCTCCCAAGG - Intergenic
964843725 3:161024031-161024053 CTGCCCGTCTGGGCCTCCCAAGG - Intronic
964864534 3:161241660-161241682 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
965136840 3:164784176-164784198 CTGCCCGCCTAGGCCTCCCAAGG + Intergenic
965312638 3:167149919-167149941 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
965713924 3:171582182-171582204 CCGCCCGCCTTGGCCTCCCAAGG + Intergenic
965819949 3:172675064-172675086 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
966190762 3:177270260-177270282 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
966379122 3:179325648-179325670 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
966402957 3:179565191-179565213 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
966410785 3:179643946-179643968 CCTCCCGCCTCGGCCTCCCAAGG - Intergenic
966482147 3:180422771-180422793 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
966602242 3:181787304-181787326 CGCCCGGCCTGGCCCTCTTATGG + Intergenic
966617324 3:181926422-181926444 CTGCCCGCCTGGGCCTCCCGAGG - Intergenic
966710431 3:182966861-182966883 CCTCCCGCCTGGGCCTCCCAAGG - Intronic
966783331 3:183603533-183603555 CCCCCCGCCTCAGCCTCCCAAGG - Intergenic
966814286 3:183876966-183876988 CCGCCCGCCTCGGCCTCCCAGGG - Intronic
966858935 3:184217545-184217567 CCACCCGCCTTGGCCTCCCAAGG - Intronic
966862063 3:184236130-184236152 CGCCCTCCCTGGCCCTCCACAGG + Exonic
966899786 3:184472794-184472816 CCACCCGCCTCGGCCTCCCAAGG + Intronic
967022383 3:185533978-185534000 CTGCCCGCCTCGGCCTCCCACGG - Intronic
967064278 3:185900892-185900914 CTGCCCGCCTCGGCCTCCCAGGG + Intergenic
967082419 3:186062377-186062399 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
967183660 3:186928049-186928071 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
967826777 3:193883372-193883394 CTGCCCGCCTTGGCCTCCCATGG - Intergenic
968032109 3:195509182-195509204 CCGCCCGCCTGAGCCTCCCAAGG - Intergenic
968059887 3:195719666-195719688 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
968098720 3:195950922-195950944 CCCCCTGCCTCGGCCTCCCAAGG + Intergenic
968167755 3:196481326-196481348 CCTCCCGCCTGGGCCTCCCAAGG - Intronic
968195637 3:196703784-196703806 CCACCCGCCTTGGCCTCCCAAGG - Intronic
968716031 4:2160650-2160672 CCTCCCGCCTTGGCCTCCCAAGG + Intronic
968738996 4:2317874-2317896 CCATCCGCCTGGGCCTCCCAAGG + Intronic
968758671 4:2429832-2429854 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
968771141 4:2508088-2508110 CATCCCGCCTTGGCCTCCCAGGG + Intronic
968898935 4:3421718-3421740 CTCCAAGCCTGGGCCTCCAGAGG - Intronic
969379780 4:6786937-6786959 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
969381001 4:6797826-6797848 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
969512654 4:7628277-7628299 CCGCCCGCCTCGGCCTCCGAAGG - Intronic
970748421 4:19328686-19328708 CCTCCCGCCTTGGCCTCCATAGG + Intergenic
970998655 4:22297059-22297081 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
971270712 4:25142031-25142053 CCCCCCACCTTGGCCTCCCAGGG - Intronic
972056944 4:34815229-34815251 CTCCCTGCCAGGTCCTCCAAGGG + Intergenic
972232014 4:37084384-37084406 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
972657856 4:41082917-41082939 CTTCCCGCCTCGGCCTCCCAAGG - Intronic
972765724 4:42151459-42151481 CGCCGCGCCTGGGCTTCCGACGG - Intronic
973083584 4:46026656-46026678 CTGCCTGCCTCGGCCTCCAAAGG - Intergenic
973151071 4:46888687-46888709 CCTCCCGCCTCGGCCTCCCAAGG + Intronic
973286269 4:48420258-48420280 CTCCTCACCTGGGCCTCCTATGG + Exonic
973982263 4:56316295-56316317 GGCCCACCCTGGGCCTCCACCGG + Exonic
975858195 4:78647087-78647109 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
975916694 4:79333605-79333627 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
976256148 4:83102841-83102863 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
976608089 4:87001457-87001479 CCACCCGCCTCGGCCTCCCAAGG + Intronic
976891181 4:90049735-90049757 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
977403965 4:96572646-96572668 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
978411036 4:108425854-108425876 CCTCCCGCCTCGGCCTCCCAAGG + Intergenic
978553318 4:109951061-109951083 CCACCCGCCTTGGCCTCCCAAGG - Intronic
978875098 4:113631267-113631289 CCTCCTGCCTTGGCCTCCAAAGG - Intronic
979360538 4:119758944-119758966 CGGCCCACCTCGGCCTCCCAGGG - Intergenic
980043784 4:127966613-127966635 CCGCCCGCCTTGGCCTCCCAAGG - Intronic
980074335 4:128278325-128278347 CTACCCGCCTTGGCCTCCCAAGG - Intronic
980967496 4:139536757-139536779 CCTCCTGCCTCGGCCTCCAAAGG - Intronic
981081673 4:140643809-140643831 CTCAGCGCCTGGGCCTCCAACGG + Intronic
981318132 4:143362000-143362022 CCCCCCACCTTGGCCTCCCAAGG + Intronic
982182987 4:152765873-152765895 CTGCCCGCCTGGGCCTCCCGAGG - Intronic
982334460 4:154217740-154217762 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
983613873 4:169679643-169679665 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
983891323 4:173033244-173033266 CCACCCGCCTCGGCCTCCCAAGG + Intronic
984669280 4:182463863-182463885 CCACCCGCCTCGGCCTCCCAAGG + Intronic
984970859 4:185188585-185188607 CTGCCCACCTTGGCCTCCAAAGG + Intronic
985069126 4:186150961-186150983 CCGCCTGCCTGGGCCTCCCATGG + Intronic
985314144 4:188636814-188636836 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
985666506 5:1183999-1184021 GGCCCAGCCAGGGCCACCAAGGG + Intergenic
985677756 5:1241047-1241069 CGCCCCTCCTGAGCCTGCACGGG - Intronic
985995552 5:3595387-3595409 CGCGCGGCCGGGGCCTCCAGGGG - Intergenic
986062194 5:4202295-4202317 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
987033726 5:13999113-13999135 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
987372985 5:17209905-17209927 CCCCCCGCCTCAGCCTCCCAAGG - Intronic
987480341 5:18448167-18448189 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
987938863 5:24505870-24505892 CCTCCTGCCTGGGCCTCCCAAGG - Intronic
988259275 5:28862699-28862721 CAGCCCGCCTCGGCCTCCCACGG + Intergenic
988543642 5:32136234-32136256 CCACCCGCCTCGGCCTCCCAAGG - Intronic
988645182 5:33087234-33087256 CCTCCTGCCTTGGCCTCCAAAGG - Intergenic
990721521 5:58701242-58701264 CCACCCGCCTTGGCCTCCCAAGG + Intronic
991068151 5:62446723-62446745 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
992563768 5:77977581-77977603 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
992749375 5:79848402-79848424 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
993468384 5:88276101-88276123 GGTCCCGCCTTGGCCTCCCAAGG - Intergenic
993510015 5:88759237-88759259 CCACCCGCCTGGGCCTCCCAAGG - Intronic
993943327 5:94088435-94088457 CCTCCCGCCTTGGCCTCCCAAGG - Intronic
994728510 5:103464406-103464428 CGGCCCACCTGGGCTTCCTATGG - Intergenic
995032126 5:107492753-107492775 CCGCCCGCCTCGGCCTCCGAAGG - Intronic
996376869 5:122820292-122820314 CCACCCGCCTCGGCCTCCCAAGG - Intronic
996549551 5:124715898-124715920 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
997978807 5:138456262-138456284 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
998013975 5:138717722-138717744 CCTCCCGCCTTGGCCTCCCAAGG - Intronic
998413591 5:141929491-141929513 CCACCCGCCTCGGCCTCCCAAGG + Intronic
998595978 5:143530976-143530998 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
999278085 5:150345669-150345691 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
999293885 5:150445844-150445866 CGCCCTGCCTTAGCCTCCCAAGG - Intronic
999401091 5:151264734-151264756 CCACCCGCCTCGGCCTCCCAAGG - Intronic
999414613 5:151383814-151383836 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
999757911 5:154679016-154679038 CCGTCCGCCTGGGCCTCCCAGGG - Intergenic
999765831 5:154740146-154740168 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1000007209 5:157198039-157198061 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1000070953 5:157740656-157740678 CTGCCTGCCTGGGCCTCCCAAGG - Exonic
1000589618 5:163143320-163143342 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1000735903 5:164900157-164900179 CCTCCCGCCTCGGCCTCCCAAGG + Intergenic
1000791987 5:165619242-165619264 CCTCCCGCCTTGGCCTCCGAAGG - Intergenic
1001041151 5:168336325-168336347 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1001406524 5:171480999-171481021 CGCCCCACCTGGGGCTCCACTGG + Intergenic
1001805995 5:174586972-174586994 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1001912002 5:175528150-175528172 CCGCCCGCCTTGGCCTCCCAAGG + Exonic
1002020132 5:176358839-176358861 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1002147904 5:177200350-177200372 CCTCCCGCCTCGGCCTCCCAAGG + Intronic
1002744477 5:181459634-181459656 CCTCCCACCTGGGCCTCCAAAGG - Intergenic
1002763281 6:218205-218227 CTCCCCAGCAGGGCCTCCAAAGG - Intergenic
1002945374 6:1756513-1756535 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1003101325 6:3178604-3178626 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1003206840 6:4020542-4020564 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1003292523 6:4792133-4792155 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1003342573 6:5236219-5236241 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1003388839 6:5694757-5694779 CCTCCTGCCTAGGCCTCCAAAGG - Intronic
1003601190 6:7519059-7519081 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1003672552 6:8172902-8172924 CGACCCGCCTTGGCCTCCCAAGG - Intergenic
1003733947 6:8856633-8856655 CCTCCCACCTTGGCCTCCAAGGG + Intergenic
1004231793 6:13840431-13840453 CCTCCTGCCTTGGCCTCCAAAGG + Intergenic
1004383344 6:15151039-15151061 CTGCCCACCTCGGCCTCCAAAGG + Intergenic
1004447251 6:15711670-15711692 CCGCCCGCCTTGGCCTCCCAAGG + Intergenic
1004545873 6:16597681-16597703 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1004621415 6:17333738-17333760 CTGCCCGCCTAGGCCTCCCAAGG + Intergenic
1004631496 6:17425849-17425871 CGGCCCACCTTGGCCTCCCAAGG - Intronic
1004682420 6:17909290-17909312 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1004721459 6:18271281-18271303 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1004922295 6:20387182-20387204 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1005523941 6:26626964-26626986 CCACCCGCCTTGGCCTCCTAAGG + Intergenic
1005626314 6:27665683-27665705 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1005697137 6:28362042-28362064 CCTCCTGCCTGGGCCTCCCAAGG + Intronic
1006366808 6:33621065-33621087 CACTACGCCTGGGCCTCCCAGGG + Exonic
1006543399 6:34758781-34758803 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1006709259 6:36051350-36051372 CCTCCCGCCTCGGCCTCCCAAGG + Intronic
1006981846 6:38153758-38153780 CACCCTGCCTGGGCTTTCAAGGG - Exonic
1007096445 6:39216037-39216059 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
1007099326 6:39234041-39234063 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1007648164 6:43398643-43398665 CCGCCCGCCTCGGCCTCCAAAGG + Intergenic
1007770495 6:44187919-44187941 CGGCCTGCCTCGGCCTCCCAAGG - Intergenic
1008106424 6:47444389-47444411 CTGCCCGCCTGGGCCTCCCGAGG - Intergenic
1008129278 6:47702080-47702102 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1008153653 6:47988018-47988040 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1008909387 6:56716936-56716958 CCGCCCGCCTTGGCCTCCCAAGG - Intronic
1010121982 6:72386975-72386997 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1011264933 6:85506557-85506579 CCCCCCGCCTTGGCCTCCCAAGG + Intronic
1011601035 6:89060719-89060741 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1011799772 6:90999131-90999153 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1012991873 6:105934441-105934463 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1013030342 6:106326330-106326352 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1013097112 6:106955485-106955507 CCTCCCGCCTCGGCCTCCCAAGG + Intergenic
1013105806 6:107025907-107025929 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1013362536 6:109407480-109407502 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1014031144 6:116706444-116706466 CCACCCGCCTTGGCCTCCCAGGG - Intronic
1014443315 6:121497989-121498011 CCGCCCGCCTTGGCCTCCCAAGG + Intergenic
1015974969 6:138780813-138780835 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1016807702 6:148228890-148228912 CTGCCCGCCTCGGCCTCCAAAGG - Intergenic
1016941930 6:149489547-149489569 CCCCCTGCCTCGGCCTCCCAAGG + Intergenic
1017686864 6:156922414-156922436 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1017896348 6:158683460-158683482 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1018027409 6:159816906-159816928 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1018330345 6:162720691-162720713 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1018459032 6:163980120-163980142 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1018892727 6:167994384-167994406 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1018896740 6:168024710-168024732 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1018980797 6:168600160-168600182 CCACCCGCCTCGGCCTCCCACGG - Intronic
1019037564 6:169074246-169074268 CCCCCCGCCTCTGCCTCCCAAGG + Intergenic
1019249388 6:170733175-170733197 CCTCCCACCTGGGCCTCCAAAGG - Intergenic
1019288174 7:234091-234113 CGGCCTCCCTGGGCCTCAAAGGG - Intronic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019413689 7:917709-917731 CCGCCCGCCTAGGCCTCCCAAGG + Intronic
1019436677 7:1025808-1025830 TGCCTCCCCTGGGCCTCCAGAGG + Intronic
1019449472 7:1089837-1089859 CTGCCCGCCTTGGCCTCCCACGG - Intronic
1019554521 7:1622131-1622153 CAGCCCGCCTCGGCCTCCCAAGG - Intergenic
1019680185 7:2343430-2343452 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1019692232 7:2422486-2422508 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1019760963 7:2812384-2812406 CCGCCCGCCTCAGCCTCCAAAGG - Intronic
1019789337 7:3000652-3000674 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1020029200 7:4920959-4920981 CCTCCCACCTTGGCCTCCAAAGG + Intronic
1020192165 7:6008858-6008880 CGCCACTCCGGGGCCTCCAGGGG + Intronic
1020201793 7:6085854-6085876 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
1020262854 7:6540353-6540375 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1020643672 7:10787227-10787249 TTCCAGGCCTGGGCCTCCAAGGG + Intergenic
1020794943 7:12667720-12667742 CCACCCGCCTTGGCCTCCGAAGG - Intergenic
1020892732 7:13899883-13899905 CTGCCTGCCTTGGCCTCCAAGGG - Intronic
1021012128 7:15483321-15483343 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1021123036 7:16818489-16818511 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1021415693 7:20381403-20381425 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1021466103 7:20944985-20945007 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1021494899 7:21263793-21263815 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1021638095 7:22711025-22711047 CACCGCGCCTGGCCCTCTAAAGG - Intergenic
1021878491 7:25070713-25070735 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1022132517 7:27417258-27417280 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1022187751 7:27986898-27986920 CTGCCCGCCTGGGCCTCCCGAGG + Intronic
1022894092 7:34731935-34731957 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
1023150919 7:37200720-37200742 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1023423653 7:40011277-40011299 CCTCCTGCCTCGGCCTCCAAGGG - Intronic
1023776020 7:43608036-43608058 CCTCCCACCTTGGCCTCCAAAGG - Intronic
1023977810 7:45044377-45044399 CCTCCCGCCTCGGCCTCCAAAGG + Intronic
1024586340 7:50845085-50845107 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1024631597 7:51252977-51252999 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1024834818 7:53504459-53504481 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1025098699 7:56117180-56117202 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1025795235 7:64733492-64733514 CCACCCGCCTAGGCCTCCAAAGG - Intergenic
1026374921 7:69740763-69740785 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1026523784 7:71137380-71137402 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1026539165 7:71265366-71265388 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1026655854 7:72255969-72255991 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1026828684 7:73598874-73598896 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1026926672 7:74198906-74198928 CCACCCACCTTGGCCTCCAAAGG + Intergenic
1027129030 7:75577754-75577776 CGGCCTGCCTTGGCCTCCCAAGG - Intronic
1027606391 7:80304773-80304795 CCACCCACCTGGGCCTCCCACGG + Intergenic
1028728448 7:94116825-94116847 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1028948768 7:96610340-96610362 CCGCCTGCCTGGGCCTCCCAAGG + Intronic
1029022889 7:97384205-97384227 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1029928724 7:104347646-104347668 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1030091136 7:105860024-105860046 CCACCCGCCTTGGCCTCCAAAGG + Intronic
1030266245 7:107625162-107625184 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1030329552 7:108256770-108256792 CCGCCCGCCTTGGCCTCCCAAGG - Intronic
1031821398 7:126506534-126506556 CTGCCCGCCTGGGCCTCTCAAGG - Intronic
1032128995 7:129213830-129213852 CCACCCGCCTCGGGCTCCAAAGG + Intergenic
1032134917 7:129267546-129267568 CTGCCCACCTTGGCCTCCAAAGG + Intronic
1032820894 7:135523555-135523577 CCTCCCACCTTGGCCTCCAAAGG - Intergenic
1033009155 7:137601026-137601048 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1033140315 7:138820709-138820731 CTACCCGCCTCGGCCTCCCACGG + Intronic
1033393709 7:140953469-140953491 CTTCCCGCCTCGGCCTCCCAAGG - Intergenic
1034420059 7:150985866-150985888 CCTCCCACCTGGGCCTCCCAAGG + Intergenic
1034632470 7:152541252-152541274 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1034917449 7:155052531-155052553 CTGCCCGCCTGGCCCTCCCAAGG - Intergenic
1035147725 7:156837078-156837100 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1035498709 8:74472-74494 CCTCCCACCTGGGCCTCCAAAGG + Intronic
1035707768 8:1690110-1690132 CAGCCCGCCTTGGCCTCCCAAGG - Intronic
1036661979 8:10714752-10714774 CGCCCCTCCTGGGCCTGAACCGG + Intergenic
1037134700 8:15446480-15446502 CTGCCCGCCTGGGCCTCCTGAGG - Intronic
1037266508 8:17067681-17067703 CCTCCTGCCTCGGCCTCCAAAGG + Intronic
1037356758 8:18028906-18028928 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1037397622 8:18459808-18459830 CCACCCGCCTTGGCCTCCCATGG - Intergenic
1037846123 8:22283650-22283672 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1037902239 8:22694893-22694915 CGGCCCGCGTGGCCCTCCCACGG - Intergenic
1038000181 8:23384668-23384690 CCGCCCGCCTCGGCCTTCAAAGG - Intronic
1038328370 8:26589222-26589244 CACCCAGGCTGGGCCACCAAGGG - Intronic
1038505496 8:28081073-28081095 CGGCCCACCTTGGCCTCCCAAGG - Intronic
1038894253 8:31763705-31763727 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1039450274 8:37668020-37668042 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1039564248 8:38538757-38538779 CCCCCTGCCTTGGCCTCCTAAGG + Intergenic
1040001710 8:42582632-42582654 CCATCCGCCTGGGCCTCCCAAGG + Intergenic
1040531613 8:48270871-48270893 TGCCCAGCCTGGGCCTCCACTGG - Intergenic
1041261698 8:56026139-56026161 CCTCCCGCCTTGGCCTCCCAAGG + Intergenic
1041722849 8:60991989-60992011 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1042153650 8:65817993-65818015 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1042887343 8:73567262-73567284 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1043127133 8:76413098-76413120 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1043434263 8:80223103-80223125 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1043711869 8:83430164-83430186 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1044580541 8:93821653-93821675 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1045099595 8:98830725-98830747 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1045508003 8:102792246-102792268 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1045626323 8:104056159-104056181 CTGCCCGCCTTGGCCTCCCAAGG - Intronic
1046166860 8:110448575-110448597 CCACCCACCTGGGACTCCAAAGG - Intergenic
1046269787 8:111879835-111879857 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1046845141 8:118907105-118907127 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1047069093 8:121322359-121322381 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1047248677 8:123165764-123165786 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
1047429521 8:124779023-124779045 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1047776994 8:128079965-128079987 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1047941021 8:129827314-129827336 CTGCCCGCCTTGGCCTCCCAGGG - Intergenic
1048930271 8:139309498-139309520 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1049029610 8:140024638-140024660 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1049099315 8:140567879-140567901 CAGCCCGCCTCGGCCTCCCACGG - Intronic
1049148737 8:141020726-141020748 CGACCCACCTTGGCCTCCCAAGG - Intergenic
1049407478 8:142458102-142458124 CGCCCACCCTAGGCCACCAATGG - Intronic
1049535005 8:143175472-143175494 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1049834598 8:144726625-144726647 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1049988209 9:971188-971210 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1050219905 9:3375715-3375737 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1050432333 9:5574477-5574499 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1052239933 9:26259368-26259390 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
1052458416 9:28731230-28731252 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1052996431 9:34553762-34553784 AGCCCAGCCTGGGCCTGGAAGGG - Intronic
1053363266 9:37504640-37504662 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1053375054 9:37599169-37599191 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1053511154 9:38688616-38688638 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1053721349 9:40950215-40950237 CCACCCGCCTCGGCCTCCAAAGG + Intergenic
1054344649 9:63901953-63901975 CCACCCACCTCGGCCTCCAAAGG - Intergenic
1054772966 9:69100208-69100230 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1054784540 9:69198383-69198405 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1054833971 9:69657086-69657108 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1054842830 9:69761175-69761197 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1054900213 9:70360933-70360955 CTGCCCGCCTCGGCCTCCCAAGG - Intergenic
1055150281 9:72989817-72989839 CTGCCCACCTCGGCCTCCAAAGG - Intronic
1055199977 9:73647842-73647864 CCACCCGCCTTGGCCTCCCAGGG + Intergenic
1055836505 9:80449217-80449239 CTTCCCACCTTGGCCTCCAAAGG - Intergenic
1055925355 9:81504724-81504746 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1056164985 9:83932377-83932399 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1056166683 9:83947756-83947778 CTGCCCGCCTGGGCCTCCCGAGG + Intronic
1056202679 9:84291577-84291599 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1056509488 9:87289669-87289691 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1056817438 9:89811848-89811870 CTCCCCACCTGGGACTCCACAGG - Intergenic
1057186935 9:93062270-93062292 GGCCCTGCCTGGCCCTCCCACGG - Intronic
1057244346 9:93441528-93441550 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1057294648 9:93828058-93828080 CGCCCGCCCTGGGCCGCCAGCGG - Intergenic
1057338517 9:94177936-94177958 AGCCCCTCCTGGGCCTCTGATGG - Intergenic
1057357406 9:94343265-94343287 CTGCCCGCCTTGGCCTCCCAAGG - Intergenic
1057359087 9:94357096-94357118 CCCCCCGCCTTGGCCTTCCAAGG + Intergenic
1057648672 9:96900494-96900516 CCCCCCGCCTCGGCCTTCCAAGG - Intronic
1057650346 9:96914361-96914383 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1057769852 9:97957999-97958021 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
1057838160 9:98463877-98463899 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1057894778 9:98900340-98900362 CCCTCCGCCTTGGCCTCCCAAGG + Intergenic
1058378630 9:104354540-104354562 CCACCCGCCTTGGCCTCCAAAGG + Intergenic
1058580555 9:106451754-106451776 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1059059407 9:111019592-111019614 CTGCCCGCCTCGGCCTCCCAAGG - Intronic
1059143589 9:111877031-111877053 CCTCCCACCTTGGCCTCCAAAGG + Intergenic
1059150680 9:111947101-111947123 CCGCCCGCCTTGGCCTCCCAAGG + Intergenic
1059218028 9:112584882-112584904 CGCCCCGCCTTTGCCTGCATTGG + Intronic
1059535860 9:115080015-115080037 CCACCCGCCTCGGCCTCCTAAGG - Intronic
1059566823 9:115390899-115390921 CTGCCCGCCTTGGCCTCCCAAGG + Intronic
1059952523 9:119481218-119481240 CCACCCACCTGGGCCTCCCAGGG - Intergenic
1060303332 9:122389392-122389414 CCACCCGCCTCGGCCTCCTAAGG + Intronic
1060322458 9:122576476-122576498 CTGCCCGCCTTGGCCTCCCAAGG + Intergenic
1060345459 9:122811902-122811924 CCGCCCGCCTTGGCCTCCCAAGG + Intronic
1060410816 9:123399037-123399059 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1060637614 9:125211722-125211744 CCACCCGCCTTGGCCTCCCAAGG - Intronic
1060765407 9:126292047-126292069 CACCACGCCTGGCCCTCCTAAGG + Intergenic
1061096724 9:128461660-128461682 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1061730545 9:132610709-132610731 CTGCCTGCCTGGGCCTCCCAAGG + Intronic
1061759315 9:132839185-132839207 CCACCCGCCTAGGCCTCCCACGG + Intronic
1061771479 9:132926918-132926940 CCACCCGCCTCGGCCTCCTAAGG + Intronic
1061773264 9:132944280-132944302 CGCCCCTCCTTGGCCCCCGAGGG - Intronic
1062299025 9:135853796-135853818 CGCTTCTCCTGGGCCTTCAATGG + Intronic
1062398210 9:136361112-136361134 CGCCGCGCCCCGGCCTCCCACGG + Intronic
1062448734 9:136606725-136606747 CCCACTGCCTGGGCCTCCCAGGG - Intergenic
1062662815 9:137647838-137647860 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1203430164 Un_GL000195v1:83180-83202 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1203489889 Un_GL000224v1:94867-94889 CCCCCCACCTCGGCCTCCCAAGG - Intergenic
1203502512 Un_KI270741v1:36753-36775 CCCCCCACCTCGGCCTCCCAAGG - Intergenic
1203610288 Un_KI270748v1:90128-90150 CCTCCCACCTGGGCCTCCAAAGG - Intergenic
1185459336 X:327695-327717 CCCCCCACCTCGGCCTCCGAAGG + Intergenic
1185504711 X:623896-623918 AGCCCCGCCTGCGTCTCCAGGGG + Intergenic
1185617563 X:1432584-1432606 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1185643298 X:1600088-1600110 CGCCCCGCGTTGGACTCCAGGGG - Intronic
1185651569 X:1651823-1651845 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1185653999 X:1669617-1669639 CTGCCCGCCTCGGCCTCCGAAGG - Intergenic
1185750924 X:2609224-2609246 CGCCCCACCCCGGCCTCCACTGG - Intergenic
1186109558 X:6241567-6241589 CTGCCCGCCTGGGCCTCCCAAGG - Intergenic
1186455962 X:9709979-9710001 CGTCCTGCCTTGGCCTCCCAGGG - Intronic
1187380952 X:18801737-18801759 CGACCCACCTCGGCCTCCCAAGG - Intronic
1187604019 X:20863361-20863383 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1187731463 X:22259405-22259427 CCACCCACCTGGGCCTCCCAAGG + Intergenic
1189114387 X:38327737-38327759 TGCGGCGCCTGGACCTCCAACGG - Intronic
1189160813 X:38805945-38805967 AGCAACGCCTGGGCCTCCACCGG - Exonic
1189294800 X:39910581-39910603 AGCCCTGCCTGGGCCTCTCAGGG - Intergenic
1189429901 X:40937085-40937107 CCACCTGCCTGGGCCTCCCAGGG - Intergenic
1189475868 X:41355062-41355084 CCGCCCGCCTCGGCCTCCTAAGG + Intronic
1190078324 X:47335417-47335439 CCGCCCGCCTTGGCCTCCCAAGG - Intergenic
1190317604 X:49161652-49161674 CCACCCGCCTTGGCCTCCCAAGG + Intergenic
1190358348 X:49626649-49626671 CCTCCCGCCTCGGCCTCCCAAGG + Intergenic
1192474239 X:71426014-71426036 CCGCCCGCCTTGGCCTCCCAAGG - Intronic
1192555784 X:72087985-72088007 CAGCCCGCCTCGGCCTCCCAGGG - Intergenic
1193262769 X:79428323-79428345 CCACCCGCCTTGGCCTCCCAAGG - Intergenic
1193916161 X:87366882-87366904 CCACCCGCCTCGGCCTCCCAAGG - Intergenic
1194289335 X:92050016-92050038 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1194642126 X:96414647-96414669 CCGCCCGCCTCGGCCTCCCAGGG - Intergenic
1195053532 X:101121117-101121139 CCACCCGCCTCGGCCTCCCAAGG + Intronic
1195119815 X:101738694-101738716 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic
1196198753 X:112862184-112862206 CCGCCCGCCTTGGCCTCCCAAGG + Intergenic
1196685574 X:118507591-118507613 CCATCCGCCTGGGCCTCCCAAGG + Intronic
1196694904 X:118601178-118601200 CTGCCTGCCTGGGCCTCCCAAGG - Intronic
1196739249 X:119010012-119010034 CCTCCCACCTGGGCCTCCCAAGG + Intronic
1196803499 X:119564251-119564273 CCACCCGCCTCGGCCTCCCAAGG - Intronic
1196836048 X:119815107-119815129 CCACCCGCCTCGGCCTCCCAAGG + Intergenic
1196915587 X:120531701-120531723 CTGCCCGCCTCGGCCTCCCAAGG + Intronic
1197235013 X:124051831-124051853 CCGCCCGCCTTGGCCTCCCAAGG + Intronic
1197899846 X:131358847-131358869 CCACCCGCCTTGGCCTCCCAAGG + Intronic
1199416058 X:147584347-147584369 TCACCCGCCTGGGCCTCCCAAGG + Intergenic
1199724294 X:150566379-150566401 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1199772704 X:150984310-150984332 CGCCCCGCCCGGGCCGCCCGGGG - Intronic
1200430213 Y:3071342-3071364 CTGCCCGCCTCGGCCTCCCAAGG + Intergenic