ID: 1128651894

View in Genome Browser
Species Human (GRCh38)
Location 15:69422334-69422356
Sequence ATCTAATGATAGGAATAGTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128651892_1128651894 -6 Left 1128651892 15:69422317-69422339 CCACTTCAGGTTTTCAAATCTAA 0: 1
1: 0
2: 3
3: 17
4: 276
Right 1128651894 15:69422334-69422356 ATCTAATGATAGGAATAGTATGG 0: 1
1: 0
2: 0
3: 10
4: 165
1128651889_1128651894 -3 Left 1128651889 15:69422314-69422336 CCCCCACTTCAGGTTTTCAAATC 0: 1
1: 0
2: 0
3: 19
4: 230
Right 1128651894 15:69422334-69422356 ATCTAATGATAGGAATAGTATGG 0: 1
1: 0
2: 0
3: 10
4: 165
1128651891_1128651894 -5 Left 1128651891 15:69422316-69422338 CCCACTTCAGGTTTTCAAATCTA 0: 1
1: 0
2: 2
3: 27
4: 255
Right 1128651894 15:69422334-69422356 ATCTAATGATAGGAATAGTATGG 0: 1
1: 0
2: 0
3: 10
4: 165
1128651890_1128651894 -4 Left 1128651890 15:69422315-69422337 CCCCACTTCAGGTTTTCAAATCT 0: 1
1: 0
2: 4
3: 34
4: 308
Right 1128651894 15:69422334-69422356 ATCTAATGATAGGAATAGTATGG 0: 1
1: 0
2: 0
3: 10
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128651894 Original CRISPR ATCTAATGATAGGAATAGTA TGG Exonic
905750594 1:40459910-40459932 ATGGATGGATAGGAATAGTAAGG + Intronic
907951556 1:59188563-59188585 ATCCAATGAGAGGAAGAGGAGGG - Intergenic
908918795 1:69165240-69165262 TTCTAATGAGAGGAATGGTTAGG - Intergenic
910130617 1:83900859-83900881 ATCCAGTGATGGAAATAGTATGG - Intronic
915613376 1:157014170-157014192 ATCTAATGATAGGGAGAGGGTGG - Intronic
916279650 1:163035720-163035742 ATCTAATGTTAGGAATTCTTAGG + Intergenic
919191265 1:194222873-194222895 TTCTAATGAAAGAAATAGAAGGG + Intergenic
919516230 1:198527942-198527964 ATCTAAAGAAAAGAATTGTAGGG + Intronic
919799193 1:201342853-201342875 ATATACTGATGGGAATAATATGG + Intergenic
920266688 1:204729333-204729355 GTCTTGTGATAGGAATAGTGAGG + Intergenic
924386380 1:243502020-243502042 ATCTAATGAAAGAACTAGCAAGG + Exonic
1062777859 10:169282-169304 ATCTAATCATAGGACTAAGACGG + Intronic
1064872127 10:19949464-19949486 AACTACTAATAGGAATAGGAGGG + Intronic
1066775783 10:38884963-38884985 ATGGAATGAAAGGTATAGTATGG + Intergenic
1067033834 10:42898640-42898662 AACTAATGATGGGAAAAGGAGGG + Intergenic
1068072304 10:52210366-52210388 ATCCAGTGACAGGAATAGGAGGG - Intronic
1069402983 10:68069114-68069136 ATCTAATCATAGGTATAATTTGG - Intronic
1070157558 10:73845011-73845033 ATTTAATGATAGGGAGAGTTAGG - Intronic
1073625498 10:105091576-105091598 ATCCAATGAGATGAAAAGTAAGG - Intronic
1084721875 11:70911563-70911585 TTCTAATGATAGCAATGGTGAGG - Intronic
1085540732 11:77267105-77267127 ATCCAAACATAGGAAAAGTACGG - Intronic
1087997914 11:104834390-104834412 ATATATTGATAAGAATTGTATGG + Intergenic
1088327811 11:108618852-108618874 ACACAATGATAGGAACAGTAAGG - Intergenic
1088499169 11:110465373-110465395 TTCTAATGAAAAGAATAGTTGGG - Intergenic
1088944677 11:114497485-114497507 ATCTAAACATAGAAAAAGTACGG - Intergenic
1090144730 11:124309625-124309647 ATCTTTTGATAGGAAAACTAAGG - Intergenic
1090452324 11:126817735-126817757 AGCTAATGATAGCATTTGTAGGG + Intronic
1090771849 11:129927734-129927756 ATCTAATGATACTAATGGGATGG + Intronic
1092725127 12:11477426-11477448 ATGTAATGATAAGAATAGGGTGG - Intronic
1093339383 12:17953170-17953192 ATAGAAATATAGGAATAGTAGGG + Intergenic
1093913888 12:24778512-24778534 ATTTAATGAAAAGAAAAGTAGGG + Intergenic
1094039226 12:26105405-26105427 ATCTAAGGAAAGGTATATTAAGG + Intergenic
1094143488 12:27204794-27204816 ATCTCATTATAAGAAGAGTATGG + Intergenic
1095289191 12:40456990-40457012 ATCTAATTGTAAGAATAGCATGG - Intronic
1095857225 12:46873703-46873725 ATCTAATGATAGAAATAAGAAGG + Intergenic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1105273128 13:18895967-18895989 AATAAATGATAGGAATAATATGG - Intergenic
1105631467 13:22173640-22173662 TTCTAATGAAAAGAAGAGTAAGG + Intergenic
1106805184 13:33299038-33299060 ATCTAAGCATAGAAAAAGTACGG - Intronic
1107136846 13:36954242-36954264 ATAAAATTATAGGACTAGTAAGG - Intronic
1110873643 13:80482513-80482535 ATCTAATGACTTGAATAGTTAGG - Intergenic
1110888264 13:80666248-80666270 ATCTATTAATAGTAATAATAAGG - Intergenic
1112032452 13:95470246-95470268 ATCTAATCTTAGGATTAGAAAGG - Intronic
1113000890 13:105635158-105635180 ATCAAATGATAGGACAAGAAAGG + Intergenic
1120411006 14:84155513-84155535 ATCTAATTAAAGGAATGATAGGG - Intergenic
1122674280 14:103397799-103397821 ATCTAAGAATATGAATAGGAAGG - Intronic
1124400002 15:29339548-29339570 ATCTAATGATTGAAATATTATGG - Intronic
1126385627 15:48090574-48090596 ATCAAAAGATAGGAAAAGAAAGG + Intergenic
1126884417 15:53134402-53134424 ATACAATGAGAGCAATAGTATGG - Intergenic
1127007123 15:54583144-54583166 CTCTCATGATAGGAATGGTGTGG - Intronic
1128194403 15:65738628-65738650 CTATAATGCAAGGAATAGTAGGG - Intronic
1128651894 15:69422334-69422356 ATCTAATGATAGGAATAGTATGG + Exonic
1128730767 15:70019359-70019381 ATCTAAGGATAAGAATGGCAGGG - Intergenic
1130719145 15:86369770-86369792 ATCTAATGATAGGGATAACAAGG + Intronic
1138196973 16:55059040-55059062 ATTTAATGAGGGGACTAGTAAGG - Intergenic
1138716009 16:59022988-59023010 ATCAAATGATTGGAAGAGTTAGG - Intergenic
1138935630 16:61718482-61718504 CTATAATGATATGAATTGTAAGG + Intronic
1145696043 17:26788698-26788720 ATGGAATGAAAGGAATAGAATGG + Intergenic
1150097745 17:62393225-62393247 ATGTTATAATAGGAATAATAGGG + Intronic
1151332351 17:73417905-73417927 ATCTAATTATTGGAAAATTAAGG + Intronic
1203179548 17_KI270729v1_random:45844-45866 ATATAATGAATGGAATAGAATGG + Intergenic
1153044871 18:846856-846878 AACTAATAATAGTACTAGTAAGG + Intergenic
1154464895 18:14633529-14633551 AATAAATGATAGGAATAATATGG - Intergenic
1155269190 18:24122907-24122929 ATGTAGTGATAGGAGTAGTCAGG - Intronic
1157380639 18:47212641-47212663 ATCTAATCAGAGTAATAGTTTGG - Intronic
1158385777 18:56990032-56990054 ATTAAAAAATAGGAATAGTAAGG - Intronic
1160371634 18:78377100-78377122 ATCTGATGATATAAATGGTATGG + Intergenic
926552985 2:14322596-14322618 ATCTAATGTTAGAAATGGAAAGG - Intergenic
926855785 2:17254532-17254554 ATATTATGATAGGAAGAGCATGG - Intergenic
926995512 2:18730797-18730819 ATCTAATGATGAGAAAAGTAAGG - Intergenic
928221943 2:29410680-29410702 ATCTAAACATAGAAAAAGTATGG + Intronic
928550190 2:32362660-32362682 ATCTAGTAATATGAACAGTATGG - Intronic
929198587 2:39211641-39211663 ATTTAATAATTGGAATTGTATGG - Intronic
930195257 2:48503394-48503416 ATCTAATCATAGGTAAACTAAGG - Intronic
930334149 2:50024413-50024435 ATATAAAGGTAGGAAAAGTAGGG - Intronic
931471845 2:62545838-62545860 ATTTACTGATAGGAAATGTATGG - Intergenic
932296523 2:70628130-70628152 ATCTAATTAGTGGCATAGTAGGG - Intronic
935936970 2:108196417-108196439 AGCTAATAAGAGGTATAGTAGGG - Intergenic
935943162 2:108262566-108262588 ATCTAATGTTAAGAACTGTAAGG + Intronic
939425482 2:142031235-142031257 ATCAAATCATTGGAATAGTTTGG + Intronic
939636149 2:144584673-144584695 ATCTTCAGAAAGGAATAGTAAGG - Intergenic
940404988 2:153291166-153291188 ATATTTTGATAGAAATAGTAAGG + Intergenic
940722406 2:157296884-157296906 TTCTAATGATAGCAATGGTTAGG + Intronic
943190701 2:184675793-184675815 AAGAAATGACAGGAATAGTAGGG - Intronic
943560117 2:189451403-189451425 ATCTAGTGATAGGTAAAGTATGG + Intronic
943785782 2:191877151-191877173 ATTTAATGATAAGACTAGTATGG + Intergenic
944011108 2:194976553-194976575 ATCCAAGGGTAGGAATAATATGG + Intergenic
944945594 2:204681215-204681237 ATCTGATATTAGGATTAGTATGG + Intronic
945808058 2:214514700-214514722 ATCTAATGATGAGAAAAGGAGGG + Intronic
1174861168 20:54092613-54092635 ATCTAAAGATAGAAATAGGTTGG - Intergenic
1176809641 21:13524854-13524876 AATAAATGATAGGAATAATATGG + Intergenic
1177351581 21:19949828-19949850 ATCTAATGTTAGGATAATTAAGG + Intergenic
1178106666 21:29326970-29326992 ATCTAGTGATAGGAGTAGTGTGG + Exonic
1178503028 21:33141309-33141331 ATCTAATGATAAGTTTAGGATGG - Intergenic
1178576124 21:33793220-33793242 ATCTAAAGGTAGGAATTTTAGGG + Intronic
1181121794 22:20672500-20672522 AGTAAATGATAGGAATAATATGG + Intergenic
1181834861 22:25596089-25596111 ATATCATGGTAGGAATTGTATGG + Intronic
1184420053 22:44374603-44374625 ATGTCATGACAGGAATAGAAGGG - Intergenic
951725812 3:25757632-25757654 GTCTAATGATAGCATTAATAAGG + Intronic
953865213 3:46577582-46577604 AACTAATGATAGAGATATTAGGG + Exonic
954723431 3:52585855-52585877 ATCTAATAATGGGAAAAGAAAGG - Intronic
954827374 3:53385894-53385916 ATTTAATGATAGGAAGAAGATGG - Intergenic
956114162 3:65902088-65902110 TTCTAAATATAGCAATAGTAGGG + Intronic
959707446 3:109351240-109351262 ATTTAATCATAGTAATAGAAAGG - Intergenic
960253233 3:115481165-115481187 ATCTAATCATAGAAAGTGTAGGG + Intergenic
961734785 3:128994451-128994473 ATCTAATGAGAGGGATCGTGGGG - Intronic
961734794 3:128994513-128994535 ATCTAATGAGAGGGATCGTGGGG - Intronic
965006919 3:163039496-163039518 TTCTAATCATAGGAATAATCTGG + Intergenic
965121242 3:164560272-164560294 ATTTATTGATAGGTATAGGAAGG - Intergenic
965267807 3:166569054-166569076 ATCTAAGAATAGAGATAGTAGGG + Intergenic
967213307 3:187187989-187188011 TTACAATGATAGGAACAGTATGG + Intergenic
968141948 3:196265583-196265605 ATGTAAAGAAAGGAATAGGAAGG - Intronic
968345229 3:197998704-197998726 ACCTCCTGATAGGAATTGTATGG + Intronic
971006789 4:22383245-22383267 ATCTTATTTTAGGAATAGAATGG + Intronic
972841141 4:42931516-42931538 ATCTAATGAGAGGAAGAATCTGG - Intronic
975068895 4:70106861-70106883 ACCAAAGGATGGGAATAGTAGGG - Intergenic
979001956 4:115232612-115232634 ATCTAATGTTAGGAGGAGTGAGG + Intergenic
979876861 4:125903062-125903084 ATCTAATGACAAGAAAAATATGG - Intergenic
980715887 4:136628899-136628921 ATCTAATTATGGGAATAGCTGGG + Intergenic
983354802 4:166643309-166643331 TTTTAATGATAGTAAGAGTAGGG - Intergenic
985294778 4:188424502-188424524 ATGTAATTATGGGCATAGTAGGG + Intergenic
987925590 5:24336840-24336862 CTCTAATGGGAGGAATAGTCGGG - Intergenic
992486055 5:77196992-77197014 AACTATTAATAGGAATAATAAGG - Intergenic
995822900 5:116257727-116257749 ATCAAATAAAAGGAATATTATGG + Intronic
996011423 5:118484880-118484902 ATCTATTGATATGATTAATATGG - Intergenic
997827656 5:137121817-137121839 ATATAATAATAGGGATAATAAGG - Intronic
998607944 5:143655126-143655148 ATCTAAAGAAAGGAGTGGTATGG - Intergenic
999921278 5:156323814-156323836 ATCTAATGGTAAGAATAAAAAGG + Intronic
1003609254 6:7593752-7593774 ATGTGATGATTGGAATCGTATGG - Exonic
1007990784 6:46253801-46253823 ATCTAATCATAGAAAAGGTATGG - Intronic
1008369463 6:50715823-50715845 ATCCAATGAGAGGAAGAGAACGG - Intronic
1009586084 6:65604628-65604650 AGTTAATGATAGTAATAATAAGG + Intronic
1010522402 6:76854500-76854522 ATTTAATGCTATGAATACTATGG - Intergenic
1010979472 6:82354789-82354811 ATGTAATGTTAGGATTTGTAAGG + Intergenic
1013936412 6:115600816-115600838 ATATAATGAGAGTAATGGTAGGG + Intergenic
1014773793 6:125486024-125486046 AAGTTATGATAGGAATAGCAGGG - Intergenic
1015153790 6:130067434-130067456 ATGTAATGATTGAAATAGAAGGG - Intronic
1017475903 6:154792527-154792549 TTCTAATGATATGGATGGTAAGG - Intronic
1018337141 6:162805065-162805087 ATCTAAAGATAGAAAAGGTATGG + Intronic
1020799163 7:12712225-12712247 ATTTAGTGATAGAAATATTAAGG + Intergenic
1020876841 7:13707110-13707132 ATAAAATGATAAGTATAGTATGG - Intergenic
1021111725 7:16702451-16702473 ATTTAATGTTAAGAATAGGAAGG - Intronic
1021111797 7:16703744-16703766 ATTTAATGTTAAGAATAGGAAGG - Intronic
1024830196 7:53444232-53444254 TTCTAACTATAGAAATAGTAGGG + Intergenic
1024835911 7:53518647-53518669 ATCTAATGAAGGAAATGGTATGG + Intergenic
1024837977 7:53546635-53546657 ATCTAATGATAGAACTTGAACGG + Intergenic
1024960837 7:54973602-54973624 TTCTAATTATAGGAATATTAAGG - Intergenic
1025908500 7:65808717-65808739 ATCTCATCATAGGGACAGTAGGG + Intergenic
1027428412 7:78084952-78084974 ATCTAATGAAAGAAATGGGAAGG - Intronic
1030507752 7:110445951-110445973 ATCTAATAAAAGAAATATTAGGG - Intergenic
1030568041 7:111185664-111185686 ACCTAATGAAAAGAATAGCAAGG + Intronic
1032542339 7:132713565-132713587 ATGTGATGATAGGATTAGAAAGG - Intronic
1034843966 7:154426310-154426332 AGCCAATGATAGGACTACTAGGG + Intronic
1034911418 7:155002127-155002149 ATATTATTATAGGAATACTAAGG + Intronic
1035926046 8:3728818-3728840 AACTAATGTTAGAAATATTAAGG - Intronic
1038774073 8:30512381-30512403 AACTCATGTTAAGAATAGTATGG - Intronic
1041411357 8:57560134-57560156 ATCTACAGATAGCAATAGAAAGG + Intergenic
1043943017 8:86217509-86217531 TATTAATGATAGGAATACTAAGG - Exonic
1044334307 8:90960869-90960891 ATATAATGTTAGGAAATGTAGGG + Intronic
1045890337 8:107148525-107148547 TTTTAATGGAAGGAATAGTATGG - Intergenic
1046391193 8:113574921-113574943 ACCAAATGATAGTAATAATACGG - Intergenic
1046724939 8:117664065-117664087 TTATAGTGATAGGAATAGTACGG - Intergenic
1050122229 9:2319329-2319351 ATGAAATGAAAGCAATAGTAAGG + Intergenic
1050824060 9:9921847-9921869 AGGTAATGATAGGAATGTTATGG - Intronic
1051443237 9:17110923-17110945 ATCTACTGATAGTATTATTATGG + Intergenic
1055676725 9:78670568-78670590 ATCAAATGAGAGGAACAGTTTGG + Intergenic
1059697167 9:116740331-116740353 ATCTAGTGATAGAAAGAGCATGG + Intronic
1203676527 Un_KI270756v1:27361-27383 ATGGAATGAAAGGAATAGGATGG - Intergenic
1203677010 Un_KI270756v1:31301-31323 ATGGAATGAAAGGTATAGTATGG - Intergenic
1187794927 X:22993373-22993395 ATCTAATCATATGAATTCTATGG + Intergenic
1187867643 X:23738673-23738695 AGCTAATGGTAGCAATAGAAAGG - Intronic
1188737216 X:33732740-33732762 ATCAAAAGATAGGAACAGTAAGG + Intergenic
1191629081 X:63301296-63301318 AACTATTGATAAGATTAGTATGG - Intergenic
1192378622 X:70590293-70590315 ATCAAATTATAGGAATTATAAGG - Intronic
1195596362 X:106695383-106695405 AACTTATGTTAAGAATAGTATGG + Intronic
1195975341 X:110520742-110520764 AACTAATGATAGAGATATTAGGG + Intergenic