ID: 1128654771

View in Genome Browser
Species Human (GRCh38)
Location 15:69452720-69452742
Sequence CAGGCGCCTTCAGTGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128654768_1128654771 -5 Left 1128654768 15:69452702-69452724 CCAATCAGGCGCAGTGCGCAGGC 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1128654771 15:69452720-69452742 CAGGCGCCTTCAGTGGGTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128654771 Original CRISPR CAGGCGCCTTCAGTGGGTCC TGG Intergenic
900241437 1:1619391-1619413 CTGGCCCCTCCAGAGGGTCCAGG + Intronic
901503885 1:9671869-9671891 CAGGCCCCTTGAGTGGGGCCAGG - Intronic
901505921 1:9685832-9685854 CAGGCGCCCTCAGTCGTGCCTGG + Intronic
902454289 1:16521000-16521022 CAGGCTCCTTCAATGGGTGAAGG - Intergenic
903652566 1:24930541-24930563 AGGGCGCCTTCCGTGGGACCCGG - Intronic
904266163 1:29319613-29319635 CAGGAGCCTTCAGAGAGTCCTGG + Intronic
904610659 1:31724515-31724537 CAGATGCCTTCTGTGGATCCTGG - Intergenic
904629514 1:31830469-31830491 CTGGCAGCTTCAGAGGGTCCTGG - Intergenic
904834735 1:33328141-33328163 CAGATGCCTTCAGTGGGGCCTGG - Intronic
904864774 1:33569756-33569778 CAGGCACCTGCAGTGGAGCCGGG - Intronic
905285604 1:36878147-36878169 CAGGAGCTTTCAGTGTCTCCAGG - Intronic
905289855 1:36913815-36913837 CAGGTGACTTCAGTGGATTCTGG - Intronic
907289362 1:53402978-53403000 CACCCCCGTTCAGTGGGTCCTGG - Intergenic
909348164 1:74616595-74616617 CAGCCGACTACAGTGGGTTCAGG - Intronic
912975255 1:114323893-114323915 CATGGGCCCTCAGTGGGCCCTGG + Intergenic
913655080 1:120952664-120952686 CAGGCTCCTTCACTGGGTGAAGG - Intergenic
914006433 1:143736337-143736359 CAGGCTCCTTCACTGGGTGAAGG - Intergenic
914201234 1:145487355-145487377 CAGGCTCCCTCAGTGGGTGAAGG - Intergenic
914480351 1:148060487-148060509 CAGGCTCCCTCAGTGGGTGAAGG - Intergenic
914645265 1:149646824-149646846 CAGGCTCCTTCACTGGGTGAAGG - Intergenic
915489973 1:156245503-156245525 CAGGCCCCTCCAGTGGGGACGGG - Intronic
916151142 1:161792312-161792334 CAGGTACCTTTAGTGGGTGCAGG - Exonic
917444066 1:175091938-175091960 CAGGCCTCTGCTGTGGGTCCTGG + Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918053455 1:180995892-180995914 CAGGCACCTTCTGGGGGTGCTGG + Intronic
921587633 1:216966528-216966550 CATATGCCTTCAGTGGGTGCAGG + Intronic
923293860 1:232573746-232573768 CGGCCGCTCTCAGTGGGTCCAGG + Intergenic
923472359 1:234303374-234303396 CAGGAGCCTTCTGCGGTTCCCGG + Intronic
1063058655 10:2528229-2528251 AAGGCGGCTTCAGTGGATCAAGG + Intergenic
1063358352 10:5424272-5424294 CAGGAGCCATCAGTGGGCACTGG - Intronic
1065594044 10:27295098-27295120 CAGCTGCCTTCTGTGTGTCCTGG - Intergenic
1067088476 10:43254922-43254944 GAGGGGCCTCCAGTGGGCCCTGG - Intronic
1067183371 10:44006948-44006970 GAGGTGCCTTAAGTGGGTGCTGG - Intergenic
1069606889 10:69744352-69744374 CAGCCACCTTCAATGGGTCATGG + Intergenic
1069884655 10:71616107-71616129 CAGGCGGCTGCAGCGGGTGCGGG - Intronic
1072633582 10:97163710-97163732 CAGGCAGCTTCAGAGGGTCAGGG - Intronic
1073630935 10:105148508-105148530 CAAGTTCCTTCACTGGGTCCAGG - Intronic
1077144130 11:1037195-1037217 CAGGGCCCTTCAGGGGGTGCTGG - Intergenic
1077894490 11:6443507-6443529 GAGGCCCCTTCTGTGGGTCCTGG + Intergenic
1079122848 11:17697380-17697402 CAGGCACCTGCTATGGGTCCTGG - Intergenic
1082982615 11:59137287-59137309 CGGGCGCCTTGAGAGGGTCTTGG + Intergenic
1084301349 11:68254603-68254625 CAGGCCCCTGCCGTGGGCCCTGG + Intergenic
1087157613 11:94920277-94920299 CCTGGGCCTTCAGTGGGCCCAGG - Intergenic
1089587978 11:119522071-119522093 CAGGCACATTCAGTGGGCCTGGG + Intergenic
1092487757 12:8916926-8916948 CAGACACATTCAGTGGGTCATGG - Intronic
1093497954 12:19779358-19779380 CAGGGGCCTTGGGTGGGACCTGG + Intergenic
1103827315 12:123750101-123750123 CAGGGGCGTTCAGTGGGCACAGG + Intronic
1103951634 12:124554591-124554613 CAGCCCCCGTCCGTGGGTCCAGG - Intronic
1105899215 13:24741799-24741821 CAGGAGGCCTCAGTGGCTCCAGG - Intergenic
1107964957 13:45589714-45589736 CAGGCCCCTTCACTGTGTCTGGG + Intronic
1108171994 13:47751253-47751275 CAGGCAACTTCAGTGGGTAGGGG - Intergenic
1110460936 13:75745115-75745137 CAGGAGCCTGGAGTGGGCCCTGG + Intronic
1112422094 13:99261684-99261706 CATGGGACTTCAGTGGTTCCAGG - Exonic
1118852103 14:69591988-69592010 CTGGCTCTTTCACTGGGTCCAGG - Intergenic
1122502162 14:102207998-102208020 GAGGCGGCCTCAGTGGGCCCAGG + Intronic
1122641825 14:103164545-103164567 CAGATGCCTTCAGTGGCCCCAGG - Intergenic
1127533209 15:59865228-59865250 CAGGTTCCTCCAGAGGGTCCAGG + Intergenic
1128654771 15:69452720-69452742 CAGGCGCCTTCAGTGGGTCCTGG + Intergenic
1128780919 15:70358154-70358176 CAGTCTCCTTCAGTGTCTCCTGG - Intergenic
1129644774 15:77419938-77419960 CACGCGCCGTCTGTGGGACCAGG - Intronic
1131012675 15:89031781-89031803 CAGGAGCCCTCAGCGGATCCGGG + Intergenic
1131470242 15:92690234-92690256 CAGGAGGCCTCAGTGAGTCCTGG - Intronic
1132295433 15:100730912-100730934 CCAGCACCTTCAGTGGGCCCTGG - Intergenic
1132676536 16:1123516-1123538 AAGGCTCCTGCAGAGGGTCCAGG - Intergenic
1133473879 16:6101248-6101270 CATGCACCTTCAGTGGGTGTAGG + Intronic
1135048653 16:19174430-19174452 CAGGCTCCAGCTGTGGGTCCTGG - Intronic
1136275903 16:29179471-29179493 GAGGCGCCTGCAATGGGCCCAGG + Intergenic
1140057371 16:71537120-71537142 CAGGAGCCTGCAGTGAGCCCGGG - Exonic
1142593784 17:1019824-1019846 CAGGTGCCTTCCATGGGCCCAGG + Intronic
1144624493 17:16837877-16837899 CAGGCACCCCAAGTGGGTCCAGG - Intergenic
1144881934 17:18434843-18434865 CAGGCACCCCAAGTGGGTCCAGG + Intergenic
1145150299 17:20509543-20509565 CAGGCACCCCAAGTGGGTCCAGG - Intergenic
1150891332 17:69153503-69153525 CAGGAGCCTTAAGTTGTTCCTGG + Exonic
1151548703 17:74808907-74808929 CAGGAGCCCCCAGTGGGTCATGG + Intronic
1152947358 17:83205373-83205395 CAGGCCACATCAGTGGGTGCAGG - Intergenic
1157718407 18:49905247-49905269 CCAGTGCCTACAGTGGGTCCAGG - Intronic
1157901979 18:51526716-51526738 CAGGGGCCTGCAGGTGGTCCTGG - Intergenic
1159955581 18:74516283-74516305 AAGGCGCCTTCTCTGGGTCTGGG + Exonic
1160152104 18:76403048-76403070 CAGGCGCCTTTGGTGGTTTCTGG - Intronic
1160810440 19:1010795-1010817 CAGGCGCCGCCACTGGGCCCCGG - Exonic
1160918213 19:1507624-1507646 CAGGTGCCTTCGCTGGGTACTGG - Exonic
1161237711 19:3206098-3206120 CAGGCCCCTGCAGTGGGGCTGGG - Intronic
1164318540 19:24117147-24117169 CAGACTCCTCAAGTGGGTCCCGG - Intronic
1165326155 19:35115640-35115662 CAGGCTCTTTCCGTGGGTGCTGG - Intergenic
1166765980 19:45252156-45252178 CAGGCGCCCTGGGTGCGTCCTGG - Intronic
1167119950 19:47510925-47510947 CTGTCGCCTTCAGTGGCTGCTGG + Intronic
1167527630 19:49994873-49994895 GAGGAGCCTTCAGTCGGCCCTGG - Exonic
1167982161 19:53284291-53284313 CAGGCGCTTGCCCTGGGTCCTGG + Intergenic
1167983983 19:53299682-53299704 CAGGCGCTTGCCCTGGGTCCTGG - Intergenic
925591117 2:5511004-5511026 CTGGCGCCTTCAGTGTGATCAGG - Intergenic
927123360 2:19989891-19989913 CAGGCTCCTTCACCCGGTCCTGG - Intronic
929780256 2:44952679-44952701 CAGGCGGCGCCAGTGTGTCCCGG - Intergenic
930290828 2:49490998-49491020 CATGCACCTTCAGTGGGTCTAGG + Intergenic
933934317 2:87188687-87188709 GAGGCGCCGTCACTGGGTACAGG - Intergenic
934165386 2:89289638-89289660 CAGGCTCCTTCAGAGGCTCCAGG + Intergenic
934201888 2:89892824-89892846 CAGGCTCCTTCAGAGGCTCCAGG - Intergenic
934707773 2:96496841-96496863 CAGGGGCCTTGTGTGAGTCCCGG - Intergenic
936081963 2:109438366-109438388 CTGGCACCATCAGTGGGTGCAGG + Intronic
938314375 2:130315860-130315882 CTGGCAGCTTCAGTGGGTCTGGG - Intergenic
940987444 2:160062956-160062978 CAGGCGCTTTGGGAGGGTCCTGG + Intergenic
945470640 2:210224856-210224878 CAGCGGCCTGCAGTGGGACCCGG - Intronic
946189122 2:217998401-217998423 GAGGCCCCATCAGTGGGGCCAGG + Intronic
947736147 2:232456515-232456537 CCGGGACCTTCAGTGGTTCCAGG + Intronic
948129975 2:235593023-235593045 CAGGGGCCTTCAGCAGGTCAGGG - Intronic
948515322 2:238499903-238499925 CAGGTCCCCTCAGTGTGTCCTGG - Intergenic
1169666330 20:8040769-8040791 CTGGCACCTTCAGAGGTTCCAGG + Intergenic
1169908293 20:10625168-10625190 GAGGCGCCTACAGTGGGCCATGG - Exonic
1170443150 20:16398811-16398833 CAGGCGGCTTCACAGGGACCTGG + Intronic
1172210076 20:33191227-33191249 CATCAGTCTTCAGTGGGTCCTGG - Intergenic
1175216638 20:57394780-57394802 CAGGCGCCTGCTGTGGGCCTGGG - Intronic
1176065298 20:63191183-63191205 CAGGGGCCTCCAGTGTATCCTGG - Intergenic
1176173588 20:63707537-63707559 CCGGCGCCTGCAGGGGCTCCTGG - Intronic
1177260638 21:18725193-18725215 CATGTGCCTTCAGGGGGCCCAGG + Intergenic
1178308384 21:31509391-31509413 CATGGCCCTTGAGTGGGTCCTGG - Intronic
1179905985 21:44423672-44423694 CCGACCTCTTCAGTGGGTCCAGG - Exonic
1181088969 22:20458993-20459015 CAGGAGCCCTCCTTGGGTCCTGG - Intronic
1181783757 22:25211008-25211030 CAGGCCCCTTGACTGGCTCCTGG + Intergenic
1181863206 22:25835261-25835283 CAGGGCCCTTCAGTGAATCCTGG + Intronic
1183683471 22:39348976-39348998 CAGTCACCTTCACTGGTTCCAGG - Intergenic
1185118533 22:48951962-48951984 CAGGAGCCTTCAGTTGCTGCTGG - Intergenic
1185249764 22:49794579-49794601 CAGGCAGCCTCAGTGGGTCCTGG - Intronic
950450046 3:13060376-13060398 CAGGCTCCTGCGGTGGGGCCCGG + Intronic
954199294 3:49014685-49014707 CTGGAGCCTCCAGTGGATCCTGG + Exonic
954240879 3:49292523-49292545 CAGGGGCCTGCAATGGCTCCAGG - Exonic
954337737 3:49929626-49929648 CCGGCACCTTCTGTGCGTCCTGG - Exonic
954704168 3:52470148-52470170 CAGGAGCCTTCAGTGGCTCAGGG + Intronic
956764662 3:72474230-72474252 CAGTCGGCTTCAGTGGGCCCTGG + Intergenic
962290976 3:134136101-134136123 GAGGAGCCTGCAGTGGGTCCAGG + Intronic
962876494 3:139539506-139539528 CAGTCGACTTCACTGGGTACTGG - Exonic
969150732 4:5166665-5166687 CAGGAGCCTTCAGAGGGGGCAGG + Intronic
969477138 4:7428069-7428091 CAGCCGTCATCTGTGGGTCCTGG + Intronic
969611490 4:8229794-8229816 CAGCAGCCTCCGGTGGGTCCTGG + Intronic
974174944 4:58309771-58309793 CACACGCCTTCTGTGGCTCCAGG - Intergenic
978941696 4:114444070-114444092 CCAGTGTCTTCAGTGGGTCCTGG + Intergenic
985262297 4:188126357-188126379 GAGGAGTCTTCAGTGAGTCCAGG - Intergenic
985671187 5:1207417-1207439 CAGGCCCCTTCTCTGGGTGCTGG + Intronic
985772478 5:1821553-1821575 CTGGAGCCTTCAGTGGGAGCAGG - Intergenic
987705155 5:21453672-21453694 CAGGTGCTTTCTGTTGGTCCAGG + Intergenic
988300772 5:29423523-29423545 CAGGTGCTTTCTGTTGGTCCAGG - Intergenic
989025671 5:37064699-37064721 CAGGCTCCTACAGTGGCTCCTGG + Exonic
989257070 5:39377198-39377220 CAGTCCCCTTCAATGGCTCCGGG - Exonic
990901149 5:60750286-60750308 CAAACATCTTCAGTGGGTCCTGG + Intergenic
991548030 5:67805337-67805359 CAGGAGCCGTCTGTGGGTCTTGG - Intergenic
993431778 5:87841312-87841334 CATGCACCTTCAGTGGGTCAAGG - Intergenic
998719386 5:144927339-144927361 CAGGCCCATTCAGTGAATCCTGG + Intergenic
999309469 5:150542746-150542768 CAGGAGCCCCCAGTGGGTCGTGG + Intronic
999317706 5:150594894-150594916 CAAGGGGCTTCAGTGGGGCCTGG + Intergenic
1002644559 5:180646762-180646784 CAGGCTCCTTCCCTGGGTCGGGG + Intronic
1006170060 6:32087388-32087410 CAGCCGCCTGCAGAGGGCCCCGG - Intronic
1006446815 6:34084348-34084370 CAGGAGCCATCAGTGGGGCAGGG + Intronic
1007482725 6:42160703-42160725 CAGGAGTCTTCAGTGGTTCCTGG + Intronic
1021183289 7:17533497-17533519 CAGCCACCTTCAGTGGGCACTGG - Intergenic
1023189831 7:37568448-37568470 CAGGAGCCATGGGTGGGTCCAGG + Intergenic
1023750148 7:43364583-43364605 CAGGCGCCATGAGTGGGCCTTGG + Intronic
1031966562 7:128031697-128031719 CAGGCCCCTTCAGAGAGTCCGGG + Intronic
1034478849 7:151304372-151304394 CAGTGGCTCTCAGTGGGTCCCGG + Intergenic
1034846824 7:154454161-154454183 CAGGTGGCTTGAGTGGGTTCTGG + Intronic
1036032696 8:4991631-4991653 CAAGCGCCTCCGGTGGGCCCTGG + Intronic
1037812625 8:22096009-22096031 CAGCAGCCTTCTGTGGGCCCAGG + Intronic
1045710395 8:104976312-104976334 CAGGAGCCTTCAGTGGGCTGAGG - Intronic
1048296846 8:133220830-133220852 CAGGAGCCTTCGGTGGGTGTGGG + Exonic
1049418255 8:142505356-142505378 CAGGCACCTCCACTGAGTCCGGG - Intronic
1049478122 8:142806299-142806321 CAGGAGCCTTCTGAGAGTCCTGG - Intergenic
1056009795 9:82315610-82315632 CTGCCATCTTCAGTGGGTCCTGG + Intergenic
1060107893 9:120885665-120885687 CATGAGCCATAAGTGGGTCCAGG + Intronic
1061177323 9:129005599-129005621 CTGGGGCCTTAATTGGGTCCTGG + Intronic
1061617535 9:131790195-131790217 CAGATGCCTTCTCTGGGTCCGGG + Intergenic
1061837905 9:133341506-133341528 CAGGCGTGCTCAGTGGGGCCAGG + Exonic
1062388655 9:136325321-136325343 TGGGCCCCTGCAGTGGGTCCTGG - Intergenic
1062658114 9:137614555-137614577 CCGGCGCCTTCAGAGAGACCTGG - Exonic
1192405825 X:70885233-70885255 CAGGCACCAACAGTGGGTCAAGG + Intronic
1197563028 X:128047674-128047696 GAAGGGCCTTCAGTGGCTCCTGG + Intergenic
1200034734 X:153319958-153319980 CTGGCGCCATGACTGGGTCCAGG + Intergenic