ID: 1128655952

View in Genome Browser
Species Human (GRCh38)
Location 15:69462244-69462266
Sequence CTCCGTGTCCAGAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128655952_1128655955 -10 Left 1128655952 15:69462244-69462266 CCCACTTCCTTCTGGACACGGAG No data
Right 1128655955 15:69462257-69462279 GGACACGGAGTCCCGCACTCAGG No data
1128655952_1128655956 -9 Left 1128655952 15:69462244-69462266 CCCACTTCCTTCTGGACACGGAG No data
Right 1128655956 15:69462258-69462280 GACACGGAGTCCCGCACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128655952 Original CRISPR CTCCGTGTCCAGAAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr