ID: 1128659196

View in Genome Browser
Species Human (GRCh38)
Location 15:69485327-69485349
Sequence CTACCCTGCCTGGGCAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128659196_1128659203 8 Left 1128659196 15:69485327-69485349 CCCGCTTTGCCCAGGCAGGGTAG No data
Right 1128659203 15:69485358-69485380 GTAGCTGGCTATGTGACCATAGG No data
1128659196_1128659201 -7 Left 1128659196 15:69485327-69485349 CCCGCTTTGCCCAGGCAGGGTAG No data
Right 1128659201 15:69485343-69485365 AGGGTAGGTCACCATGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128659196 Original CRISPR CTACCCTGCCTGGGCAAAGC GGG (reversed) Intergenic
No off target data available for this crispr