ID: 1128659203

View in Genome Browser
Species Human (GRCh38)
Location 15:69485358-69485380
Sequence GTAGCTGGCTATGTGACCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128659196_1128659203 8 Left 1128659196 15:69485327-69485349 CCCGCTTTGCCCAGGCAGGGTAG No data
Right 1128659203 15:69485358-69485380 GTAGCTGGCTATGTGACCATAGG No data
1128659199_1128659203 -1 Left 1128659199 15:69485336-69485358 CCCAGGCAGGGTAGGTCACCATG No data
Right 1128659203 15:69485358-69485380 GTAGCTGGCTATGTGACCATAGG No data
1128659197_1128659203 7 Left 1128659197 15:69485328-69485350 CCGCTTTGCCCAGGCAGGGTAGG No data
Right 1128659203 15:69485358-69485380 GTAGCTGGCTATGTGACCATAGG No data
1128659200_1128659203 -2 Left 1128659200 15:69485337-69485359 CCAGGCAGGGTAGGTCACCATGT No data
Right 1128659203 15:69485358-69485380 GTAGCTGGCTATGTGACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128659203 Original CRISPR GTAGCTGGCTATGTGACCAT AGG Intergenic
No off target data available for this crispr