ID: 1128659680

View in Genome Browser
Species Human (GRCh38)
Location 15:69489585-69489607
Sequence ACAAGTACACACATCTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128659680_1128659681 -7 Left 1128659680 15:69489585-69489607 CCATGGTAGATGTGTGTACTTGT No data
Right 1128659681 15:69489601-69489623 TACTTGTTCATTTATTCTTCAGG No data
1128659680_1128659683 11 Left 1128659680 15:69489585-69489607 CCATGGTAGATGTGTGTACTTGT No data
Right 1128659683 15:69489619-69489641 TCAGGAAATGATATGCTAGAGGG No data
1128659680_1128659682 10 Left 1128659680 15:69489585-69489607 CCATGGTAGATGTGTGTACTTGT No data
Right 1128659682 15:69489618-69489640 TTCAGGAAATGATATGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128659680 Original CRISPR ACAAGTACACACATCTACCA TGG (reversed) Intergenic
No off target data available for this crispr