ID: 1128660486 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:69497445-69497467 |
| Sequence | CTTTCTATTCTGAGTTTGGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1128660486_1128660489 | -8 | Left | 1128660486 | 15:69497445-69497467 | CCAACCAAACTCAGAATAGAAAG | No data | ||
| Right | 1128660489 | 15:69497460-69497482 | ATAGAAAGCAGATTGGCCCCTGG | No data | ||||
| 1128660486_1128660493 | 17 | Left | 1128660486 | 15:69497445-69497467 | CCAACCAAACTCAGAATAGAAAG | No data | ||
| Right | 1128660493 | 15:69497485-69497507 | TCCTCTCCAGAGAATGCTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1128660486 | Original CRISPR | CTTTCTATTCTGAGTTTGGT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||