ID: 1128660486

View in Genome Browser
Species Human (GRCh38)
Location 15:69497445-69497467
Sequence CTTTCTATTCTGAGTTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128660486_1128660489 -8 Left 1128660486 15:69497445-69497467 CCAACCAAACTCAGAATAGAAAG No data
Right 1128660489 15:69497460-69497482 ATAGAAAGCAGATTGGCCCCTGG No data
1128660486_1128660493 17 Left 1128660486 15:69497445-69497467 CCAACCAAACTCAGAATAGAAAG No data
Right 1128660493 15:69497485-69497507 TCCTCTCCAGAGAATGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128660486 Original CRISPR CTTTCTATTCTGAGTTTGGT TGG (reversed) Intergenic
No off target data available for this crispr