ID: 1128661701

View in Genome Browser
Species Human (GRCh38)
Location 15:69506032-69506054
Sequence GACCATCTCAAGTTCAGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128661701_1128661703 19 Left 1128661701 15:69506032-69506054 CCTAGCCTGAACTTGAGATGGTC No data
Right 1128661703 15:69506074-69506096 GCTTTTCCCTGCACAACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128661701 Original CRISPR GACCATCTCAAGTTCAGGCT AGG (reversed) Intergenic