ID: 1128662295

View in Genome Browser
Species Human (GRCh38)
Location 15:69510952-69510974
Sequence AAGATGGATGTCCCTACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128662295_1128662296 -10 Left 1128662295 15:69510952-69510974 CCTTGAGTAGGGACATCCATCTT No data
Right 1128662296 15:69510965-69510987 CATCCATCTTCTCCTTTCCTCGG 0: 2
1: 8
2: 83
3: 232
4: 688
1128662295_1128662297 -9 Left 1128662295 15:69510952-69510974 CCTTGAGTAGGGACATCCATCTT No data
Right 1128662297 15:69510966-69510988 ATCCATCTTCTCCTTTCCTCGGG No data
1128662295_1128662303 28 Left 1128662295 15:69510952-69510974 CCTTGAGTAGGGACATCCATCTT No data
Right 1128662303 15:69511003-69511025 GTTCTAAGCCTTTGAAATCTGGG No data
1128662295_1128662302 27 Left 1128662295 15:69510952-69510974 CCTTGAGTAGGGACATCCATCTT No data
Right 1128662302 15:69511002-69511024 AGTTCTAAGCCTTTGAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128662295 Original CRISPR AAGATGGATGTCCCTACTCA AGG (reversed) Intergenic
No off target data available for this crispr