ID: 1128662296

View in Genome Browser
Species Human (GRCh38)
Location 15:69510965-69510987
Sequence CATCCATCTTCTCCTTTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1013
Summary {0: 2, 1: 8, 2: 83, 3: 232, 4: 688}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128662295_1128662296 -10 Left 1128662295 15:69510952-69510974 CCTTGAGTAGGGACATCCATCTT No data
Right 1128662296 15:69510965-69510987 CATCCATCTTCTCCTTTCCTCGG 0: 2
1: 8
2: 83
3: 232
4: 688

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128662296 Original CRISPR CATCCATCTTCTCCTTTCCT CGG Intergenic
900140734 1:1138601-1138623 CCTGCCCCTTCTCCTTTCCTTGG - Intergenic
900311062 1:2033345-2033367 CATCCAGCTTCTCCGTCCCGTGG + Intergenic
900724089 1:4203695-4203717 CTGCCATCTTCTGCTTTCCTTGG - Intergenic
900805392 1:4764030-4764052 CATCCATCTTCTCCTGCCCTTGG + Intronic
900826436 1:4930902-4930924 CGTCCGTCTTCTCCTGTCCTTGG - Intergenic
901197460 1:7448141-7448163 CCTCCCTCCTCTCCTTCCCTGGG + Intronic
901316852 1:8315546-8315568 CCCCCATCTCCTCCTCTCCTGGG + Intergenic
901390916 1:8945539-8945561 CATCCTGCTTCTCCCTGCCTTGG + Intergenic
901438396 1:9263231-9263253 CAGCCCGGTTCTCCTTTCCTGGG + Intronic
901481035 1:9525371-9525393 CATCTGTCTTCTCCTGCCCTTGG - Intergenic
901934644 1:12619016-12619038 CAGCCAGCGTCTCCTGTCCTTGG + Intergenic
902696521 1:18144201-18144223 CTCCCATCTTCTCCTTCCCCAGG + Intronic
902781995 1:18710995-18711017 CTTCCTTCTCCTCCCTTCCTGGG + Intronic
903352287 1:22724898-22724920 CCTCCCTCTCCTCCTTGCCTGGG + Intronic
903414711 1:23174239-23174261 CATCCATCTTCTCCTGCCCTTGG - Intronic
903654773 1:24942570-24942592 CAGCCCCCTTCTCCCTTCCTGGG - Intronic
903749727 1:25613899-25613921 CATCCATCTTCTCCTGCCCTTGG + Intergenic
904208393 1:28869883-28869905 CATCCATTTCTTCCTTGCCTTGG + Intergenic
904388547 1:30163720-30163742 CATCCGTCTTCTCCTGCTCTCGG + Intergenic
904633312 1:31859994-31860016 CACTCATCTTCTCCTGCCCTTGG - Intergenic
904866000 1:33579420-33579442 CATCCAACCTCTCCTTTCCCTGG - Intronic
905038701 1:34934437-34934459 CATCCATCTTCTCCAGCCCTCGG + Intergenic
905337582 1:37256124-37256146 CATCCCTTTCCTTCTTTCCTTGG + Intergenic
905514905 1:38555480-38555502 CCTCCTTCCTCTCCTTTCCCAGG - Intergenic
905737162 1:40337514-40337536 CATCTATTTTCTCCTCCCCTTGG + Intergenic
905840662 1:41175275-41175297 CATCCATCTTCTCCTGCCCTTGG + Intronic
905861044 1:41351676-41351698 CATCGGTCTTCTCCTGCCCTTGG + Intergenic
905887721 1:41500660-41500682 TATTTATCTCCTCCTTTCCTGGG + Intergenic
905932741 1:41801123-41801145 CTTGCATCTTCTTCTTTTCTGGG - Intronic
906122813 1:43405781-43405803 CATCCATGCTCTCCCTGCCTTGG - Intronic
906768752 1:48463004-48463026 CATCCATCTTTTCCTGCCCTGGG + Intronic
907787525 1:57627162-57627184 CAGCCATCTTCTCCTGCCCTTGG + Intronic
908167286 1:61471002-61471024 CCTCCCTCTTCTCTCTTCCTTGG - Intergenic
908456721 1:64311352-64311374 CATCCATCTTTTCCTGCCCTTGG - Intergenic
908927490 1:69273854-69273876 CTTCCATCTTCTCCTGCCCTTGG - Intergenic
908960034 1:69685769-69685791 CATACTCCTTCTCCTCTCCTGGG - Intronic
908960635 1:69692987-69693009 CATCCATCTTCTCCTGCCTTTGG + Intronic
909044042 1:70687716-70687738 CATTCTTCTTTTTCTTTCCTGGG + Intergenic
909228735 1:73059114-73059136 CATTCACCTCCTCCTTTCTTAGG + Intergenic
909342256 1:74545297-74545319 CATCCATCTTCTCCTTTCCTTGG + Intergenic
909541151 1:76792876-76792898 CTTCCTTCCTCTCTTTTCCTAGG + Intergenic
909604302 1:77493296-77493318 CATCCATTTTCTCCTGCCCTTGG + Intronic
909675182 1:78231511-78231533 CATCCATTTTCTCCTGCCCTTGG + Intergenic
909981401 1:82105792-82105814 TATCCATCTTTTCATGTCCTTGG - Intergenic
910070096 1:83203252-83203274 CATTCATCTTCTCTTCTTCTTGG + Intergenic
910167284 1:84341000-84341022 CAGCCATCATCTCCTGCCCTTGG + Intronic
910499339 1:87871508-87871530 CACACATCTTCTCCTTCCATAGG + Intergenic
910675515 1:89812508-89812530 CAGCCATCTTCTCCTGTCCTTGG - Intronic
911643367 1:100312743-100312765 CATCCATCTTCTCTTGTTCTTGG + Intergenic
911943646 1:104077473-104077495 CATCCATCTTCTCCAGCCCTTGG - Intergenic
912091348 1:106080710-106080732 CGTCCTCCTTCTCCCTTCCTGGG - Intergenic
912436435 1:109665246-109665268 CATCCATCTCTGCCTATCCTGGG + Intronic
912438525 1:109679970-109679992 CATCCATCTCCGCCTATCCTGGG + Intronic
912441043 1:109698424-109698446 CATCCATCTCCACCTATCCTGGG + Intronic
913100499 1:115559847-115559869 CATCTATCTTCTCCTGCCCCTGG + Intergenic
913567205 1:120084389-120084411 CATCCATCTCCTCCTGCCCTTGG + Intergenic
913630928 1:120709156-120709178 CATCCATCTCCTCCTGCCCTTGG - Intergenic
914287956 1:146245096-146245118 CATCCATCTCCTCCTGCCCTTGG + Intergenic
914548991 1:148695842-148695864 CATCCATCTCCTCCTGCCCTTGG + Intergenic
914617691 1:149375876-149375898 CATCCATCTCCTCCTGCCCTTGG - Intergenic
914768724 1:150663763-150663785 CTTCTCTTTTCTCCTTTCCTAGG - Exonic
915254314 1:154614390-154614412 CTCCCATCTTCTTCTTCCCTAGG + Intronic
915444939 1:155969276-155969298 CCTTCATCTTCTCCTTTTCCCGG + Exonic
915807841 1:158873194-158873216 CATTCTTCTTCTCCTGCCCTTGG - Intergenic
916237194 1:162602290-162602312 CATCCATCTTCTCCTGCCCTTGG - Intergenic
916370531 1:164089393-164089415 CATCCATTTTCTCCTGCCCTAGG + Intergenic
916404819 1:164487735-164487757 CAACCTTCTTCTCCTGTACTTGG - Intergenic
916589389 1:166175805-166175827 CATCCATCCTTGACTTTCCTTGG - Intergenic
916662736 1:166936926-166936948 CTTCCCTCTTCTCCATTCCCCGG - Intronic
916682525 1:167117416-167117438 CATCCATCTTCTCCCTGACGCGG - Exonic
916688525 1:167169686-167169708 CACCCTTCTTCTCCTACCCTTGG - Intergenic
917282745 1:173394670-173394692 CATCCGTTTTCTCCTGCCCTTGG + Intergenic
917680330 1:177359211-177359233 CACCCTTCTTCTCCTATCTTTGG - Intergenic
917800153 1:178562751-178562773 CCCCCTTCTCCTCCTTTCCTAGG + Intergenic
917899775 1:179530613-179530635 GGTCCATGTTCTCCTTACCTGGG - Intronic
918009901 1:180577018-180577040 CATCCATCTTCTCCTGCTCTTGG - Intergenic
918191358 1:182177956-182177978 CACCCATCTTCACCTATCTTTGG - Intergenic
918406567 1:184216725-184216747 CCTCCATCTTCTCCTGCCCTTGG - Intergenic
918421070 1:184364615-184364637 CATCCATTTTCTCCCACCCTTGG - Intergenic
918673883 1:187257546-187257568 CATCAATCTTCTCCTGTCCGTGG + Intergenic
918693198 1:187508512-187508534 CATCTATCTTCTCCTGCCCTAGG + Intergenic
918728254 1:187953760-187953782 CTTCCATCTTCTCCTGCCCTTGG - Intergenic
918794969 1:188882574-188882596 CATCTATTTTCTCCTACCCTTGG - Intergenic
918936564 1:190929404-190929426 CATCCATTTTCTCCTGCCCTTGG - Intergenic
918956919 1:191219355-191219377 CATCTATCTTCTCCTACTCTTGG + Intergenic
918988035 1:191659454-191659476 TATCTATCTTCTCCTGCCCTCGG - Intergenic
919000006 1:191818478-191818500 TATCCATCTTCTCCTGCACTTGG - Intergenic
919152358 1:193717516-193717538 CATCTATCTTCTCCTACTCTGGG - Intergenic
919276494 1:195424257-195424279 CATCCATCTTCTCCTGCCCTAGG - Intergenic
920043331 1:203117869-203117891 CCTCCTTCTTCTCCCTTCCGCGG + Intronic
920308354 1:205033027-205033049 CATGAGTCTTCTCCCTTCCTTGG - Intergenic
921608604 1:217184088-217184110 CATCCACCTTCTCCTGTCCTTGG + Intergenic
922003238 1:221502326-221502348 CATCCATCTTCTCTTGCTCTTGG - Intergenic
922507169 1:226133301-226133323 CCTCCACCTCCTCCCTTCCTGGG + Intergenic
922662849 1:227445400-227445422 CATCCATATTCTCCTACCCTCGG + Intergenic
923237553 1:232048785-232048807 CATTCATCTGTTCCTTACCTCGG + Intergenic
924396169 1:243623568-243623590 CACTCCTCTTCTCCTGTCCTTGG + Intronic
924809478 1:247388643-247388665 CATTCACCTTCTCCTGTCCTCGG - Intergenic
1062866561 10:860448-860470 GATCCAGCTACTCCATTCCTAGG + Intronic
1063311097 10:4952775-4952797 CACCCATTTCCTTCTTTCCTAGG + Intronic
1063316701 10:5013620-5013642 CACCCATTTCCTTCTTTCCTAGG - Intronic
1064271634 10:13871102-13871124 CATCCATTATGTCCTTTCATAGG - Intronic
1064317270 10:14270016-14270038 CACCCATCTTCTCCTGTCCTTGG + Intronic
1064366774 10:14715710-14715732 CATCCATCTTCTCCTGCCCTTGG + Intronic
1064453492 10:15465367-15465389 CACCCATCTTCTCCTGCCCTTGG + Intergenic
1064503646 10:16004819-16004841 CAAGCATCTTTTCCTTTCCATGG - Intergenic
1064520170 10:16192573-16192595 CATTCGTCTTCTCCTGCCCTGGG - Intergenic
1064570840 10:16691531-16691553 CAACCTTCTTCTCCTTCCCAAGG + Intronic
1064776209 10:18780324-18780346 CATTCATCTTCTCTTGCCCTCGG - Intergenic
1065163957 10:22955021-22955043 CTTCCATCTTCTCTTGCCCTGGG - Intronic
1065259224 10:23907571-23907593 CATCCATCTTCTCCTGCCCTGGG - Intronic
1065457761 10:25925527-25925549 CATGCATGTTCTCCTGCCCTGGG + Intergenic
1065567697 10:27031517-27031539 CCTCCACCTTCTCCAATCCTAGG - Intronic
1065898464 10:30184698-30184720 CAGCCATCTGCACCTTCCCTCGG - Intergenic
1066051129 10:31636739-31636761 CATCAATCTTCTTCTGCCCTTGG - Intergenic
1066151272 10:32621726-32621748 TATCCATCTTCTCCTGCCCTTGG - Intronic
1066366302 10:34780037-34780059 CCTCCATCTTCTTCTTTCCCCGG + Intronic
1066547683 10:36518717-36518739 TATCCATCTTCTCCTGCCCATGG + Intergenic
1066649477 10:37640855-37640877 CATCCCTCTTTTCATTTTCTTGG + Intergenic
1067032363 10:42886396-42886418 CATCCCTCTTTTCATTTTCTTGG + Intergenic
1067381678 10:45779633-45779655 CATCCATCTTCATGTTTCCTAGG - Intronic
1067889378 10:50120268-50120290 CATCCATCTTCATGTTTCCTAGG - Intronic
1067983174 10:51111022-51111044 CATCTATCTGCACCTTTCCTTGG - Intronic
1068439202 10:57030348-57030370 CATCAAACCTCTCCTATCCTGGG - Intergenic
1069139047 10:64801156-64801178 CATTCATCTTCTTCTGCCCTTGG - Intergenic
1069181190 10:65361054-65361076 CATCCATCTTCTTCTGGCTTGGG + Intergenic
1069194426 10:65531308-65531330 CATCCATCTTCTCCTGCCCTTGG - Intergenic
1069825491 10:71252879-71252901 CATCCACCGTCTACTCTCCTGGG - Intronic
1069828601 10:71269350-71269372 CCCACAACTTCTCCTTTCCTGGG + Intronic
1069900191 10:71702501-71702523 CACCCATCTTACCCTGTCCTTGG + Intronic
1069931515 10:71885317-71885339 CCTCCACCCTCTCCTTTCATAGG + Intergenic
1070307745 10:75249691-75249713 CAGCCTTCCTCTCCTTTTCTTGG + Intergenic
1070731946 10:78835321-78835343 CTTCCATAATATCCTTTCCTGGG - Intergenic
1070792182 10:79196100-79196122 CCTCCATCTCCTCCATTCCTGGG + Intronic
1071139392 10:82489981-82490003 CATTCATCTTCTCTGTGCCTTGG - Intronic
1071548520 10:86547432-86547454 CATCAGTCTTCTCCTGTCTTTGG + Intergenic
1071898733 10:90094672-90094694 CATCCATCTTCTTCTGCCCTTGG - Intergenic
1072626727 10:97116836-97116858 CATCCGTCCTCTCGTTTCCATGG - Intronic
1072786598 10:98287410-98287432 CACTCTTCTTCTCCTGTCCTTGG - Intergenic
1072848464 10:98859554-98859576 CATTCATCTTCTCCTGCCCTTGG + Intronic
1073192524 10:101661810-101661832 CCTCTCTCTTCTCCTTTCCCAGG - Intronic
1073425137 10:103451599-103451621 CCTCCAGCTTCTCCTTTTCTTGG - Intronic
1073586470 10:104715333-104715355 CATCCATCTTCTCCTGTCTTTGG + Intronic
1073603437 10:104869319-104869341 CATTAGTCTTCTCCTGTCCTTGG - Intronic
1073776884 10:106796595-106796617 TATCTTTCTTCTCTTTTCCTGGG + Intronic
1073899787 10:108206539-108206561 CATCCATTTTGTCCTGCCCTTGG - Intergenic
1073922531 10:108475545-108475567 CATCCATCTTCTCCTGCCCTTGG - Intergenic
1074304267 10:112262289-112262311 CATGCATTCTCTCTTTTCCTAGG - Intergenic
1074365871 10:112857062-112857084 CATCCATCTCTTCCTGCCCTTGG - Intergenic
1074370440 10:112896523-112896545 CATCAAACTTCTCCTGCCCTTGG - Intergenic
1075134334 10:119769666-119769688 CATCCATCTTCTCCTGCTCTTGG + Intronic
1075155913 10:119975628-119975650 CCTCCATCTTCTCCCAGCCTGGG - Intergenic
1075201083 10:120404801-120404823 CACCCATTTTCTCCTGCCCTTGG + Intergenic
1075923335 10:126231551-126231573 CTTCCATCCTCTCCTTGCCCTGG + Intronic
1075926053 10:126252548-126252570 CACTCATCTTCTCCTGCCCTTGG - Intronic
1076105396 10:127818558-127818580 CATCCACATTCCCCATTCCTTGG + Intergenic
1076398217 10:130157296-130157318 TATCCATCTTCTCCTGTCTTTGG - Intronic
1076698171 10:132257031-132257053 CATCCATCTGCTCCTGGCCAGGG - Intronic
1077313568 11:1904879-1904901 TATCCTTCTCCTCCTTTCCCCGG + Intergenic
1078026302 11:7698773-7698795 CATCCTTCTTTTCCTTTCCCAGG - Exonic
1078318546 11:10312195-10312217 CATCCATCTTCTCCTGCCCTTGG + Intronic
1078404195 11:11054997-11055019 CATCCATCTTCTCCTGCCCTTGG + Intergenic
1078673445 11:13386167-13386189 CATCCATCTTTTTCTCCCCTGGG + Intronic
1078711819 11:13799756-13799778 CATCCATCTTCTCCTGCCCTTGG - Intergenic
1078827223 11:14940700-14940722 CATTCATCTTCTCCTGCACTTGG - Intronic
1079969728 11:27021422-27021444 CATCCTTCTTCTGCTGTTCTTGG + Intergenic
1080020581 11:27555549-27555571 CATCCATCTTCTCCTGCCCTTGG - Intergenic
1080335667 11:31192971-31192993 CATCCATCTTCTCCTGCTCTCGG + Intronic
1080446764 11:32344814-32344836 AATCCATCCTGTTCTTTCCTGGG - Intergenic
1080774232 11:35370879-35370901 TAGCCATCTTTTCTTTTCCTGGG - Intronic
1080987218 11:37483200-37483222 CATCCATCTTCTCCTGACCTTGG + Intergenic
1081256332 11:40900496-40900518 CATCCATCTGTTGTTTTCCTTGG - Intronic
1082731937 11:56809077-56809099 CACCCATCTTCTCATCTCATAGG + Intergenic
1083387522 11:62322655-62322677 CACCCTTCTTCTCCTGCCCTAGG + Intergenic
1083837711 11:65282793-65282815 CGTACATCTTTTCCTTTCCAAGG - Intronic
1084045938 11:66567924-66567946 CATCCAACTGCTGCTTTACTCGG + Intronic
1084800056 11:71537827-71537849 CAGCCAAGCTCTCCTTTCCTTGG - Intronic
1084972142 11:72777783-72777805 CATCTCTCTTCCCCTTACCTGGG - Intronic
1085028122 11:73250771-73250793 CATCCACCTTCTCCTGCCCTTGG + Intergenic
1086419365 11:86623257-86623279 CATCCATCTTCTCCTGCCCTTGG + Intronic
1087586005 11:100122275-100122297 CATTCTTCTCCTCCTGTCCTTGG - Intronic
1088080602 11:105907314-105907336 CATCTATCTTCTTTTTTCCATGG + Intronic
1088235868 11:107721889-107721911 CCCCCATCTTCTCCTGCCCTTGG - Intergenic
1088502303 11:110494554-110494576 CATCCATTTTCTCCTGCCCTTGG - Intergenic
1088558455 11:111087566-111087588 CATTTATTTTCTTCTTTCCTGGG - Intergenic
1089164784 11:116467426-116467448 CATCCATCTTCTCCTGCCCTTGG - Intergenic
1089308854 11:117544623-117544645 CCTTCTTCCTCTCCTTTCCTTGG + Intronic
1089649480 11:119903320-119903342 CACACATCTTCTCCTGCCCTTGG - Intergenic
1090098635 11:123770098-123770120 CATCCACCTTCTTCTGCCCTTGG - Intergenic
1090464396 11:126921127-126921149 CACCCTTCTTCTCCTGCCCTTGG + Intronic
1090510634 11:127371072-127371094 CATCTCTCTTCTCCATTTCTGGG + Intergenic
1090511541 11:127380732-127380754 CACTCATCTTCTCCTGTGCTTGG + Intergenic
1090564480 11:127972340-127972362 AATTTGTCTTCTCCTTTCCTTGG - Intergenic
1090575414 11:128096821-128096843 CATCCATTTTCTCCTGCCCTTGG + Intergenic
1090628407 11:128625538-128625560 CCACCAACTTCTCTTTTCCTCGG + Intergenic
1090859771 11:130642666-130642688 CATCCATCTTCTCCTGCCTTTGG + Intergenic
1092278408 12:7080756-7080778 CATCCATCCTATTCTTTCCCCGG + Exonic
1092445864 12:8556632-8556654 GCTCCATCTTCTCCTGGCCTTGG + Intergenic
1092695223 12:11164308-11164330 CATCCATCTCCTCCTGCCCTTGG + Intronic
1092896078 12:13011598-13011620 CATCATTCTTCTCCTTTTTTAGG - Intergenic
1093504096 12:19844645-19844667 CATCCATCTTCTCCTGGCCTTGG + Intergenic
1093773903 12:23049972-23049994 CATCCTTTTTCTCCTACCCTTGG + Intergenic
1093780580 12:23132317-23132339 CATCTATCTTCTCCTGACCTAGG + Intergenic
1094113421 12:26884719-26884741 CCTCCAGGTTTTCCTTTCCTTGG - Intergenic
1094401963 12:30071327-30071349 CATCAATCTTCTCCTGCACTTGG - Intergenic
1095348942 12:41187610-41187632 CATCCATCTTCTACTTCCACGGG - Intergenic
1096119649 12:49079777-49079799 CACCCACCTTCTCCTTCTCTTGG - Intergenic
1096896720 12:54828398-54828420 CATCTTTCTTCTCCTGCCCTTGG - Intergenic
1097320155 12:58216657-58216679 TATCCGTCTTCTCCTGCCCTTGG + Intergenic
1097474780 12:60039674-60039696 CATCCATCCTCTTTTTGCCTAGG - Intergenic
1097660907 12:62429983-62430005 CACCCTTCTTCTCCTGCCCTTGG - Intergenic
1097722777 12:63041464-63041486 TATCTATCTTCTCCTGCCCTTGG - Intergenic
1098031192 12:66256577-66256599 CATCCATCTTCTCCTGCCCTTGG - Intergenic
1098088759 12:66878459-66878481 CCTCCATTTTCTCCTCTCCCAGG - Intergenic
1098442770 12:70535662-70535684 CAACTCACTTCTCCTTTCCTGGG + Intronic
1098856206 12:75655844-75655866 CATCCCTCATCTCCTTATCTGGG - Intergenic
1098866853 12:75773017-75773039 GATCTAAATTCTCCTTTCCTAGG - Intergenic
1099485289 12:83222471-83222493 CATCCATCTTCTCTTGACCTTGG - Intergenic
1099785096 12:87252218-87252240 CATCCATCTTTTCTTGTCCTTGG - Intergenic
1099992150 12:89735082-89735104 CATCCATTTTCTCCTACACTTGG - Intergenic
1100070378 12:90709172-90709194 CATTCATCTTCTCCTGCCCTTGG - Intergenic
1100184361 12:92123030-92123052 GACCCATCTTCTCCTGTCCTTGG - Intronic
1100231091 12:92608795-92608817 CATCCTTCTTCTAGTCTCCTAGG + Intergenic
1100264299 12:92960970-92960992 CATCTATCTTCTCTTGTCCTTGG + Intergenic
1100338635 12:93656733-93656755 CATCTGTTTTCTCCTGTCCTTGG - Intergenic
1100681935 12:96934331-96934353 CCTCAATCTTCTCCTTTCAGAGG - Intronic
1100862774 12:98824185-98824207 CATCCATTCTCTGCTTTCCCTGG + Intronic
1100906099 12:99301102-99301124 CATCCATCTTCTCCTGCCCTTGG - Intronic
1101062455 12:100986316-100986338 CATCCATCTTCTCCTGCCCTTGG - Intronic
1101526186 12:105533258-105533280 CATCTATCTTCTTCTGCCCTTGG - Intergenic
1101624258 12:106423577-106423599 CACCCATTTTCTCCTGGCCTTGG - Intronic
1102220728 12:111192594-111192616 CAGACAAGTTCTCCTTTCCTAGG - Intronic
1103160728 12:118727058-118727080 CATTAATTTTCTCCTCTCCTTGG - Intergenic
1104136363 12:125943152-125943174 CATCCATCTTCTCTTGCCTTGGG + Intergenic
1104158286 12:126154115-126154137 CATCCATCTTCTCCTGCCTTTGG + Intergenic
1104259903 12:127172856-127172878 TATCCATCTTCTCCTGCGCTGGG + Intergenic
1104312598 12:127667382-127667404 CATCAAGCTTCCCCTTGCCTAGG + Intergenic
1104410254 12:128551746-128551768 CCCCCTTCATCTCCTTTCCTCGG + Intronic
1104896462 12:132167257-132167279 CATCCATCTGCGCCATCCCTTGG + Intergenic
1105755487 13:23459864-23459886 CATCCATCTTCTCCTGCCCTTGG + Intergenic
1106372282 13:29147233-29147255 CACACATCAACTCCTTTCCTTGG + Intronic
1106546304 13:30733797-30733819 CATCCATCTTCTCCTGCCCTTGG + Intronic
1106546320 13:30733877-30733899 CCTCCATCTTCTCCTGCCCTTGG + Intronic
1106643918 13:31613017-31613039 CATCAATCTTCTCCTGCCTTTGG - Intergenic
1106703402 13:32254298-32254320 CATCCATGTTCTCCTGCTCTCGG - Exonic
1106944173 13:34807554-34807576 CATTCATCTTCTCCTGCTCTAGG - Intergenic
1107836649 13:44417060-44417082 TATCCATCTTCTCCTGACTTTGG + Intergenic
1107966545 13:45603112-45603134 CATCCATCTTCTCCTGCCCTAGG - Intronic
1108078094 13:46702601-46702623 CACCCATCTCCCCTTTTCCTGGG - Intronic
1108687626 13:52834595-52834617 CATCCATATTCTCTTGCCCTGGG - Intergenic
1108704430 13:52972469-52972491 CATTCATTATCTCCCTTCCTTGG - Intergenic
1108949853 13:56078051-56078073 CCTCAATCTTTCCCTTTCCTGGG + Intergenic
1109069507 13:57746881-57746903 CATCCACCTTCTTCTGTCCTTGG + Intergenic
1109329918 13:60916846-60916868 CATCCTTTCTCTTCTTTCCTCGG + Intergenic
1109330907 13:60928631-60928653 CATCCAGATTCTCCTGCCCTTGG + Intergenic
1110233338 13:73190063-73190085 CATTCATCTTCTCCTTCTCCTGG + Intergenic
1110541646 13:76713058-76713080 CATAGGTCTTCTCCTGTCCTTGG - Intergenic
1110563754 13:76937362-76937384 CTTGCATCTTCTCCTGCCCTAGG + Intergenic
1110933292 13:81250231-81250253 GATCCATCTTCTCCTGCCCTTGG + Intergenic
1111015067 13:82370060-82370082 CATCCACTTTCTCTTGTCCTTGG + Intergenic
1111045118 13:82804999-82805021 CAGCCATCTTGTCCCTGCCTTGG - Intergenic
1111660973 13:91211292-91211314 CCTCCACCTTCTCCATTCCCAGG - Intergenic
1111967803 13:94878500-94878522 CATCCATCCCCCGCTTTCCTTGG - Intergenic
1112011616 13:95298368-95298390 CTTCCAGCTACTCCTTTCATTGG - Intronic
1112134891 13:96566386-96566408 CTTTCAGCTTCTCTTTTCCTGGG + Intronic
1112249128 13:97762698-97762720 CATCCATCTTCTTCTGCCCTTGG - Intergenic
1112696891 13:101959824-101959846 CATCCATCCTCTCCTTTCTGTGG + Intronic
1112818669 13:103304869-103304891 CACCAATCTTCTCTGTTCCTCGG + Intergenic
1113426774 13:110214628-110214650 CACCCATCTTCTCCTGCCCTTGG + Intronic
1114204359 14:20554749-20554771 CGTCCATCTTCTCCTGCCCTTGG - Intergenic
1114708295 14:24750243-24750265 CATCCATCTTCTCTTGCCTTTGG + Intergenic
1115036188 14:28859385-28859407 CATCCATTCTCTCTTTTTCTAGG + Intergenic
1116496179 14:45563435-45563457 CATCCATTTTCTCCTACTCTTGG + Intergenic
1116578297 14:46604657-46604679 CATCCATTTTCTCCTGCTCTTGG - Intergenic
1116582184 14:46655929-46655951 CATTCTTCTTCTTCTTTCTTTGG + Intergenic
1116981404 14:51174779-51174801 GAGGCATCTTCTCCTGTCCTTGG + Intergenic
1117075017 14:52093549-52093571 CATCCATCTTCTGCTCCCATTGG - Intergenic
1117206622 14:53450074-53450096 CATCCATCTCCTCTTTGCCCTGG - Intergenic
1117772655 14:59150572-59150594 AATCCATCTTCTCCTGCCCTTGG + Intergenic
1117906016 14:60588304-60588326 TATTGATCTTCTCCTGTCCTTGG + Intergenic
1118260743 14:64244542-64244564 CACCCATTTTCTCCTGCCCTTGG + Intronic
1118475722 14:66115121-66115143 CCTCCCTCTTCTCCTTACCCAGG + Intergenic
1119126785 14:72134791-72134813 CATCCACCTCCTCCTCCCCTGGG - Intronic
1119198843 14:72738194-72738216 GATCCATCTGCTCATTCCCTAGG + Intronic
1119660854 14:76450639-76450661 CATCCCCCTTCCCCTCTCCTAGG - Intronic
1120705233 14:87739020-87739042 CATCCTTCTTCTCTTGCCCTTGG + Intergenic
1120757912 14:88261453-88261475 CATCCCTTTTCTTCTTTCATGGG - Intronic
1124259225 15:28173197-28173219 GATCCATCCACTCCTCTCCTAGG + Intronic
1124708423 15:31984657-31984679 ACTCCATCTTCTCCTGTCCTTGG - Intergenic
1125281932 15:38051166-38051188 AATTCAACTTCTCCTTCCCTGGG - Intergenic
1125903438 15:43369966-43369988 CATCTATCTTCCCATGTCCTTGG + Exonic
1126465463 15:48957512-48957534 CATCCGTCTTCTCCTGTCTAAGG - Intronic
1126535862 15:49763476-49763498 CATCCATCTTCTCCTGCCCTGGG + Intergenic
1126896989 15:53268577-53268599 CATCTATCTTCTCTTGACCTTGG - Intergenic
1126901398 15:53318300-53318322 CATTCATCTTCTCCTACCTTTGG - Intergenic
1126904768 15:53352540-53352562 CATCCATCTTCTCCCGCCCTTGG - Intergenic
1127910030 15:63409169-63409191 CATCCATCTTCTCCCGTCCTTGG - Intergenic
1128643143 15:69354893-69354915 CACCCTTCTTCTCCTTCCCTTGG + Intronic
1128662296 15:69510965-69510987 CATCCATCTTCTCCTTTCCTCGG + Intergenic
1128732124 15:70028387-70028409 CATTCATCTTCTCCTGCCCGTGG - Intergenic
1130841903 15:87708665-87708687 TATCCATCTTCTCTTGCCCTGGG + Intergenic
1130908661 15:88256651-88256673 CTTCCTTCTCTTCCTTTCCTCGG - Exonic
1131068165 15:89447660-89447682 CCTCCAGCTCCTCCTCTCCTGGG - Intergenic
1131357542 15:91758654-91758676 AATCCATCTTCATCTTTCCAGGG + Intergenic
1131612145 15:93976496-93976518 CTTCTATCTTCTCCTGTACTTGG - Intergenic
1131742005 15:95403089-95403111 CATCCTTCTTCTGCTCCCCTTGG + Intergenic
1131953939 15:97711168-97711190 CTTCCATCTTCTCCTGCCCTAGG + Intergenic
1131963295 15:97810895-97810917 CATCCACCTTCTTATTGCCTAGG - Intergenic
1131975648 15:97943260-97943282 TATCCATCTTTTCCTGCCCTTGG - Intergenic
1132143793 15:99415036-99415058 TTTCCAGCTTCTCCTTCCCTGGG - Intergenic
1132152367 15:99471588-99471610 CATCTATCTTCTCCTGTCCTTGG + Intergenic
1132363461 15:101237376-101237398 CGGCCTTCTTCTCCATTCCTAGG - Intronic
1132945778 16:2530818-2530840 CATCCGTCGCCTGCTTTCCTGGG - Exonic
1133445102 16:5853068-5853090 TATCCATAGTCTCTTTTCCTAGG - Intergenic
1133577523 16:7107982-7108004 CATCCCCCTTTTTCTTTCCTAGG - Intronic
1133695156 16:8256201-8256223 CATCCATCTTCTCCTGCCCTCGG - Intergenic
1133748132 16:8702844-8702866 CATCAACCTTCTCCTCTCATGGG - Intronic
1133850104 16:9495475-9495497 CATCCATCTTCTCCTACTCTTGG + Intergenic
1133984063 16:10654609-10654631 CATCCATCTTCTCCTACCCTTGG + Intronic
1134254437 16:12600172-12600194 CATCCATCTCCTCCTGTCATGGG + Intergenic
1134739429 16:16529515-16529537 CATTCACCTTCTCCTGACCTTGG - Intergenic
1134761607 16:16719540-16719562 AATCCAGCTTCTCCTTTCCATGG - Intergenic
1134890206 16:17834800-17834822 CATCAGGCTTCTCCTTTCTTGGG - Intergenic
1134928070 16:18182636-18182658 CATTCACCTTCTCCTGACCTTGG + Intergenic
1134984450 16:18639630-18639652 AATCCAGCTTCTCCTTTCCATGG + Intergenic
1135110511 16:19687226-19687248 CTTCCCTCTTCTCCATTGCTGGG + Intronic
1136093075 16:27934590-27934612 CTTCCGTATTCTCCTTTCCTTGG - Intronic
1137603524 16:49772210-49772232 CATCCGTCTTCTCCTGCCCTTGG - Intronic
1137891680 16:52169707-52169729 CATCCATCTTCACTTGCCCTTGG + Intergenic
1138183670 16:54960508-54960530 CATCTATCATCTCCACTCCTGGG - Intergenic
1138184771 16:54968100-54968122 TTTCCAACTTCTCCTTACCTTGG + Intergenic
1138211667 16:55168203-55168225 CATCCATTTTCGCCTTTTCCTGG + Intergenic
1138235692 16:55380397-55380419 CATCGGTCTTCTCCTTTCTGAGG - Intergenic
1138238195 16:55403448-55403470 CATCCATCTTCTCCTGCTCCTGG - Intronic
1138720032 16:59069216-59069238 CATTCACCTTCTCCTACCCTTGG - Intergenic
1138846027 16:60567663-60567685 CATCTATCTTCTCCTGCCCTGGG + Intergenic
1138866504 16:60827841-60827863 CATCCATCTTCTTCTACCCTTGG + Intergenic
1139290828 16:65856389-65856411 AAACCATTTTCTCCCTTCCTAGG + Intergenic
1139296144 16:65902815-65902837 CATCCATCTTCTCCTGCCCTTGG + Intergenic
1140570284 16:76097026-76097048 CAACCAACTTTTTCTTTCCTTGG + Intergenic
1140682801 16:77401835-77401857 TATCCATCTTCTTCTGCCCTAGG + Intronic
1140937248 16:79684759-79684781 CATCCATCTTCTCCTGCCCTTGG + Intergenic
1141757999 16:86006011-86006033 CAGCTATCTTCTTCTTTCCCAGG + Intergenic
1143532933 17:7516219-7516241 CATCCAACTTCTCCTGCCTTTGG - Intergenic
1144010108 17:11139630-11139652 CATCCATCTTCTCTTGCCATAGG + Intergenic
1144022891 17:11252546-11252568 CATCCATCCACTCCTTTCTAAGG + Intronic
1144313859 17:14040009-14040031 CATCTATCTTCTCCTGCCCGTGG + Intergenic
1144419095 17:15079659-15079681 TATCCATCTTCTCCTGTCCTTGG - Intergenic
1144552086 17:16249706-16249728 CATTCTTCTTCTCCTGTCTTTGG - Intronic
1144675087 17:17156919-17156941 CAACCATTTCCTCTTTTCCTTGG + Intronic
1145892806 17:28429573-28429595 CATTCCTCTTCTCCTGTTCTTGG - Intergenic
1145895372 17:28454468-28454490 CATCCATCTTCTCCTGCCCTGGG + Intergenic
1145949361 17:28804130-28804152 CATCTATCTTCTCCTCCCCTTGG + Intronic
1146684749 17:34834164-34834186 CCTCTTTATTCTCCTTTCCTTGG + Intergenic
1146720662 17:35121291-35121313 CATCCTTATTCTCCTTCCCAGGG + Exonic
1147280674 17:39358150-39358172 CATTCATTTTCTCTTTTCCTTGG - Intronic
1147697939 17:42370559-42370581 CAGCCATCTTCTCATTTCTTTGG + Intronic
1148698536 17:49575265-49575287 CTTCCCTCTTCTACTTTACTTGG - Intergenic
1148815485 17:50324982-50325004 CATCCATCTTCCCTTGCCCTTGG - Intergenic
1149307524 17:55363457-55363479 CATTCATCTTCTCCTGCTCTTGG - Intergenic
1149373680 17:56022092-56022114 TATCTATCTTCTCCTGCCCTTGG + Intergenic
1149427289 17:56567453-56567475 CATCCATCTTCTCTTGCCCTTGG + Intergenic
1149479936 17:56995082-56995104 CATCCAGCATCTCTTTTCCTGGG - Intronic
1150103987 17:62448194-62448216 CTTCCAAATTCTCCGTTCCTGGG + Intronic
1150424843 17:65069022-65069044 CATCCCTAGTCTCCTTTCCCAGG + Intergenic
1150744125 17:67802510-67802532 CATTCTTCCTCTCCTGTCCTTGG - Intergenic
1151440575 17:74126349-74126371 CTTCCTTCTACTCCTTCCCTGGG - Intergenic
1152029326 17:77831934-77831956 CAACCATCTTCTCCCACCCTCGG + Intergenic
1153162760 18:2227513-2227535 CATCCAACTTCTCCTGCCTTTGG + Intergenic
1153185493 18:2481552-2481574 CATCCATCTTCTCCTGCCCTTGG - Intergenic
1153215944 18:2821210-2821232 CATCCATCTTCTCTCACCCTTGG - Intergenic
1153432304 18:5030993-5031015 CATCCATCTTCTCCTGCCTTTGG - Intergenic
1153452901 18:5249267-5249289 CACCCTTCTTCTCCTGCCCTTGG - Intergenic
1155119664 18:22805404-22805426 CATCTATCTTCTCCTGCCCTCGG - Intronic
1155190388 18:23424124-23424146 CATCCATCTTGCCCCTTTCTGGG - Intronic
1155588406 18:27395816-27395838 CATCCATCTTCTCCTGCCCTTGG - Intergenic
1155589351 18:27408465-27408487 CATCCATCCTCTCCTGCCATGGG - Intergenic
1155728577 18:29122334-29122356 CACCCATCTCCTCCTGTCCTGGG + Intergenic
1155813552 18:30272315-30272337 CAACCATCTTCCCCATTTCTAGG - Intergenic
1156304592 18:35865515-35865537 CCTCCATCTCCTCCAGTCCTAGG + Intergenic
1156307575 18:35892746-35892768 CACCCTTCTTCTCCTGCCCTTGG + Intergenic
1156319870 18:36009357-36009379 CCTCCATATCCTCCTTTCTTGGG - Intronic
1156367135 18:36439809-36439831 CATCCATCTTTTCCTGCACTAGG - Intronic
1156521948 18:37729459-37729481 CATCCATCTTCTTCTGTCCTTGG + Intergenic
1156744120 18:40368772-40368794 CATCCATCTTCTCCCATTCTGGG + Intergenic
1156781318 18:40854011-40854033 CCTCAATTTCCTCCTTTCCTGGG + Intergenic
1157324573 18:46659307-46659329 CACCCTTCTTCTCCTGTCCTTGG - Intergenic
1157440477 18:47707815-47707837 TGTCCATCTTCTCTTGTCCTTGG + Intergenic
1157571950 18:48718539-48718561 CATCCATCTTCTCCTGCCCTTGG - Intronic
1157831471 18:50860478-50860500 CATCTAGCTTCTCCTGCCCTTGG - Intergenic
1157894509 18:51452199-51452221 CACCCATCTTCTCCTGCCCTTGG - Intergenic
1158555806 18:58473790-58473812 CATTGATCTTCTCTTGTCCTCGG - Intergenic
1159040054 18:63316685-63316707 CATCAATCATCTACTTTTCTTGG + Intronic
1159609537 18:70510466-70510488 CATCTGTCTTCTCCTGCCCTTGG - Intergenic
1159650207 18:70969475-70969497 CATTCATCTTTTCCTGCCCTAGG - Intergenic
1159722502 18:71909951-71909973 CATCCATCTTCTCCTGCTCTCGG + Intergenic
1159857866 18:73610956-73610978 CATACATCATCATCTTTCCTAGG - Intergenic
1160087415 18:75789667-75789689 CATCTTTCTTCACCTTCCCTTGG - Intergenic
1162867753 19:13561729-13561751 CATCAATTTTCTCCTGCCCTTGG + Intronic
1163179482 19:15588804-15588826 CATCCATCTTCTCCTGCCCTTGG - Intergenic
1163186618 19:15643629-15643651 CATCCATCTTCTCCTGCCCTTGG - Intronic
1163222234 19:15929880-15929902 CATCCATCTGCTCCTGTCCTTGG + Intronic
1164656227 19:29924040-29924062 CATCCACCTTCTCCTGCCCTGGG - Intronic
1164885873 19:31778180-31778202 CACCCATCTTCTCCTGACCTTGG + Intergenic
1165126132 19:33599167-33599189 AAACCATCCTCTCCTTTCTTTGG - Intergenic
1165399208 19:35586899-35586921 CCTGCATCTGCTCCTATCCTGGG + Intergenic
1166868318 19:45854514-45854536 GATCCATCCTCTTCTTTCCTGGG - Intronic
1168143818 19:54407890-54407912 CATCCATTTTCTCTTGCCCTAGG - Intergenic
1168313075 19:55471322-55471344 CATCAATCTTCTCCTGCCCTCGG - Intergenic
925140192 2:1544730-1544752 CACCCTTCTTCTCCTGCCCTTGG + Intergenic
925569110 2:5289842-5289864 CATCCATCTTCTCTTGCCCTTGG + Intergenic
925695007 2:6567232-6567254 CATCCACATCCTCCTCTCCTGGG - Intergenic
925759931 2:7174763-7174785 CATCCATTTTCTCCTGCCATTGG + Intergenic
925960210 2:9006809-9006831 CATCCATCATCTCCTGCCCTCGG - Intergenic
926096931 2:10087449-10087471 CATCCAAATTCTCCTTCTCTTGG + Intergenic
926842104 2:17092414-17092436 CATCAGTCTTCTCCTTTCCTTGG + Intergenic
926954003 2:18273319-18273341 CACCTATCTTCTCCTGCCCTAGG - Intronic
927073769 2:19556017-19556039 TATCTCTCTTCTGCTTTCCTGGG - Intergenic
927126294 2:20014514-20014536 CAACCAGCTTCTCCTGTCCTTGG - Intergenic
927906823 2:26864511-26864533 CATCCACCTTTTCCTTTCCGTGG - Intronic
927972510 2:27314800-27314822 CATCCTTCTGCCCCATTCCTTGG + Intronic
928267080 2:29821229-29821251 CACCCATCTTCTCCTACCCTCGG + Intronic
928345883 2:30495644-30495666 CCTCAATCTTCTCATTTCATAGG + Intronic
928443385 2:31312064-31312086 CCTCCATCTCCTCCCTTCCTAGG + Intergenic
928599808 2:32893498-32893520 TGTCCATCTTCTCCTGCCCTTGG + Intergenic
928713520 2:34034279-34034301 CATTCATCTTCTCCTGCCCTTGG + Intergenic
929199330 2:39218703-39218725 CGTCCATCTTCTCCTGCCCTTGG + Intronic
929465719 2:42141892-42141914 CTTCCAGCTTCTCATTTCCCAGG + Intergenic
930114895 2:47710165-47710187 CATCCATCTTCTCCTGCCCTTGG + Intronic
930605038 2:53484884-53484906 TATCCATCTTCTCCTGCCCTGGG + Intergenic
930631823 2:53761471-53761493 CATGCATCTTCTCCTGCCCTTGG + Intronic
930875005 2:56205320-56205342 CAGACATTTTCTCCTTTCTTTGG + Intronic
930940703 2:57010986-57011008 CATTCATCTTCTCCTGTCCTTGG - Intergenic
931209275 2:60177336-60177358 CATTCATCTTCTCCTACCCCTGG + Intergenic
931934976 2:67186851-67186873 CATCCACCAACTCCTTGCCTTGG - Intergenic
932289739 2:70566779-70566801 CATCCACCTTCTCCTGGTCTTGG + Intergenic
932574091 2:72953351-72953373 AATCCATCTCCTACTTTGCTTGG - Intronic
933031245 2:77331498-77331520 CATCCATTCTCTCCTTTTATTGG + Intronic
933272413 2:80247358-80247380 CTCCAATCTTCTCCTTTCATAGG - Intronic
933423626 2:82083506-82083528 CATCCATCTCCTCCTGAGCTGGG + Intergenic
933423630 2:82083530-82083552 CATCCATCTCCTCCTGCCTTTGG + Intergenic
933560794 2:83883520-83883542 CATCCATCTTCTCTCCTCCTTGG - Intergenic
933595635 2:84280452-84280474 CATCTATCTTCTCCTGCCCTTGG - Intergenic
933660072 2:84920428-84920450 CATCCTTCTTCTTCTGACCTTGG + Intergenic
933939196 2:87231552-87231574 CATCCATCTTCTCCTGCCCTGGG + Intergenic
934029110 2:88025504-88025526 CATCCATCTTCTCCTTTTCTTGG - Intergenic
934618080 2:95787484-95787506 CAGCCATCTTCTCCTACCCTTGG - Intergenic
934642813 2:96037075-96037097 CAGCCATCTTCTCCTACCCTTGG + Intronic
935127764 2:100239426-100239448 CATACAAATTCTCTTTTCCTTGG + Intergenic
935511682 2:103983902-103983924 CATTCATCTTCTCCTGACCTTGG + Intergenic
935622040 2:105138509-105138531 CATCCATCTTCTCCTAGCCCTGG - Intergenic
935762029 2:106330080-106330102 CATCCACCTTCTGCTTCCCCGGG - Intergenic
935935884 2:108182587-108182609 CTTCCATCAACTCCTTTCATAGG + Intergenic
935953394 2:108351356-108351378 CATCCTCCTTTTCTTTTCCTTGG - Intergenic
936353938 2:111734224-111734246 CATCCGTCTTCTCCTGCCCTGGG - Intergenic
936500400 2:113062060-113062082 CCTCCTTCTTCCCCTGTCCTGGG - Intronic
936595640 2:113844849-113844871 TATCCATCTTTTCCTTCTCTGGG + Intergenic
936610200 2:113995053-113995075 CACCCATCTTCTCCTGCCCTTGG - Intergenic
936627538 2:114164402-114164424 CATCCATCTTCTCCTGTCCTTGG + Intergenic
936672078 2:114668323-114668345 CATTCATCTTCTTCTTCTCTTGG - Intronic
936984795 2:118298685-118298707 CATCTGTCTTCTCCTGTCCCTGG + Intergenic
937447433 2:121970856-121970878 CATCCATGGAGTCCTTTCCTGGG + Intergenic
937454135 2:122026702-122026724 CATCCATCTTCTCCTGCCCTTGG - Intergenic
937556739 2:123167196-123167218 CATTGATCTTGTCCTTTCTTTGG - Intergenic
938195432 2:129323364-129323386 CATCCACCTGCTCCTGTCCTGGG - Intergenic
938454725 2:131452644-131452666 CATCCATCTTCTCCAGAACTTGG - Intergenic
939141099 2:138355478-138355500 AATCAATCATGTCCTTTCCTGGG - Intergenic
939168586 2:138666926-138666948 CGTCCATATTCTCCTGCCCTTGG + Intergenic
939298523 2:140302736-140302758 CATCCATCTTCTCCTGGCTGAGG + Intronic
939720641 2:145646064-145646086 CATCCATATTCTCCTGCCCTTGG - Intergenic
939761682 2:146190236-146190258 CATCTAATTCCTCCTTTCCTTGG - Intergenic
939967368 2:148623683-148623705 CATCCTTCTTCTCCTTTTCTTGG + Intergenic
940126678 2:150333796-150333818 CATCCATCTTCTTATGTCCTTGG - Intergenic
940215684 2:151301143-151301165 CATCCATCTACTTCTGTCCTTGG + Intergenic
940544209 2:155062478-155062500 TATCAGTCTTCTCCTGTCCTTGG - Intergenic
940978562 2:159974770-159974792 CATCTAACTTCTCTTTTTCTCGG + Intronic
941280287 2:163541338-163541360 CATTCATCTTTTCTTTTCCCTGG - Intergenic
941408069 2:165117007-165117029 AAGACATCTTCTCCTCTCCTAGG + Intronic
941581721 2:167304914-167304936 CAGCTATCTTCTCCCGTCCTTGG - Intergenic
942225202 2:173808770-173808792 CTTCCTTCTTCTTCTGTCCTTGG - Intergenic
942497162 2:176551933-176551955 CATCCATCTTCTCCTGCCCTTGG + Intergenic
942862183 2:180628042-180628064 CATCCATCTTCTGCTGCTCTTGG - Intergenic
942872637 2:180753745-180753767 CACCCATCTTCTTCTGCCCTTGG - Intergenic
942877750 2:180822722-180822744 CATCCATCTTTTTCTGCCCTTGG + Intergenic
943847353 2:192669155-192669177 CAACCATCTTCTTCTGCCCTTGG + Intergenic
944424279 2:199563226-199563248 CACCCTTCCTCTCCTGTCCTTGG - Intergenic
945087428 2:206146434-206146456 CATCTATCTACTCCATTTCTTGG + Intronic
945506438 2:210647112-210647134 CTTCCACCTTCCCCTCTCCTTGG - Intronic
945701550 2:213176905-213176927 CATCCATCTTCTTCTGCCCTGGG - Intergenic
946031313 2:216707413-216707435 CATCCATTTTCTCCTGCCCTTGG + Intergenic
946924927 2:224617081-224617103 CTTACATGTTCTGCTTTCCTTGG - Intergenic
946983292 2:225243240-225243262 CATTCATGTTCTTCTTTTCTGGG - Intergenic
947233149 2:227909723-227909745 CATCCATCTTCTCTGGCCCTCGG - Intronic
947299399 2:228672022-228672044 CATTCATCTTCTCCTGCCCTTGG - Intergenic
947897752 2:233691432-233691454 CAGGCTTCTTCTCCCTTCCTGGG + Intronic
948386211 2:237582501-237582523 CATCCATCCTGTCCCTCCCTCGG + Intronic
1168946168 20:1760013-1760035 CACCAATCTTCTCCTGCCCTTGG - Intergenic
1169155212 20:3323773-3323795 CATTCTACTTCTCCTTTACTTGG - Intronic
1169175178 20:3505242-3505264 CACCTGTCTTCTCCTCTCCTTGG + Intronic
1169353567 20:4889635-4889657 CCTCTATCTGCTCCCTTCCTCGG + Intronic
1169368482 20:5010271-5010293 CATTCATCTTCTCCTGCCCTTGG - Exonic
1169472075 20:5895151-5895173 CAGCAATCTTCTGCATTCCTTGG + Intergenic
1169499152 20:6142442-6142464 CATCCGTCTTCTTTTCTCCTCGG - Intergenic
1169775884 20:9252803-9252825 CATCCATTTCCTCCTGTCTTTGG + Intronic
1170621363 20:17999119-17999141 CACCCTTCTTCTCCTGCCCTTGG - Intronic
1171078283 20:22151403-22151425 CATCTATCTTCTCCTGCCCTTGG - Intergenic
1172302016 20:33857054-33857076 CCTCCATCCTCTCCTGTTCTGGG + Intergenic
1173139949 20:40473111-40473133 CATCCATCTTATTCATTCCTAGG + Intergenic
1173304994 20:41839652-41839674 CATCCATCTTCTCCTGCCCTTGG - Intergenic
1173324645 20:42021572-42021594 CATCCATCATCTCCTGCCCTTGG + Intergenic
1173452799 20:43180141-43180163 CATCCATCCTCTCCTTCCCTTGG + Intronic
1174012287 20:47459813-47459835 CATCCACCTTCTCCTGCCATTGG + Intergenic
1174403068 20:50286397-50286419 CATCCATGTTCGCCTTCCCAAGG + Intergenic
1174713967 20:52737028-52737050 CCTCCAGCTTCTCCCTTTCTTGG - Intergenic
1174812193 20:53655648-53655670 AATCCACCTTCTCCTTTTATTGG - Intergenic
1174931389 20:54819085-54819107 CATCAGTCTTCTCCTACCCTTGG + Intergenic
1174931424 20:54819554-54819576 CATCAGTCTTCTCCTACCCTTGG - Intergenic
1175212215 20:57367353-57367375 CATCTATCATGTCCTTTCCATGG + Intronic
1176520096 21:7817945-7817967 CATCCATCCTCGGCCTTCCTTGG + Exonic
1176956234 21:15107321-15107343 CATCCATCTTCTCTGTTCTCTGG - Intergenic
1177001224 21:15615582-15615604 CATGCATCCTCTTCTTTTCTAGG + Intergenic
1177662426 21:24102889-24102911 CATCTATCTTCTCCTGCCTTTGG + Intergenic
1177695876 21:24569563-24569585 CATCTATCTTCTCCTGCCCTTGG - Intergenic
1177867774 21:26533460-26533482 CATTCATCTTCTTCTGCCCTTGG - Intronic
1177895520 21:26852531-26852553 CATCAGTCTTCTTCTGTCCTTGG - Intergenic
1177923333 21:27182556-27182578 CATCCATCTTCTCCCGCCCCTGG - Intergenic
1178441228 21:32600218-32600240 CATCTATTTTCTCTTTTACTTGG - Intronic
1178463571 21:32825794-32825816 CATCCGTCTTCTTCTGCCCTTGG - Intergenic
1178654123 21:34447957-34447979 CATCCATCCTCGGCCTTCCTTGG + Intergenic
1178691671 21:34755063-34755085 CTTCCTTCTTCTCCTTTTCCTGG - Intergenic
1178805439 21:35835544-35835566 CATCCATCTTCTCCTGACCTTGG - Intronic
1179245158 21:39626882-39626904 CATTTCTCTTCTACTTTCCTAGG + Intronic
1179825577 21:43964046-43964068 CATCCATCTCCTAATTTCTTTGG - Intronic
1180347525 22:11716323-11716345 CATCCACCTCCTCTTTTACTTGG + Intergenic
1180622186 22:17169531-17169553 CAGCCTTCTTCTCCTGCCCTTGG + Intergenic
1181838875 22:25637107-25637129 CATCTATCTTCTCCTGCCCTTGG + Intronic
1181937929 22:26451953-26451975 CATCCCTCTTTTCCTTCCCTGGG - Exonic
1181980303 22:26761373-26761395 CCTCAAACTTCTCCCTTCCTTGG + Intergenic
1182892418 22:33829973-33829995 CTTCCATCTCATCCTTTCCTTGG - Intronic
1183692718 22:39399955-39399977 CAGCCACCTTCTCCTCTCCTCGG + Intronic
1183871054 22:40742547-40742569 CATCCATTTTCTCTTGCCCTTGG + Intergenic
1184448164 22:44565897-44565919 CATCCATCTTCTTCTACCCCTGG + Intergenic
1184647213 22:45902960-45902982 CATCTTCCTTCTCCTTTTCTGGG - Intergenic
1184869220 22:47223987-47224009 AATCTATCTTCTCCTTTCACTGG + Intergenic
1185002006 22:48251928-48251950 CAGCCATGTCCTCCTTGCCTGGG + Intergenic
1185002015 22:48251982-48252004 CAGCCATGTCCTCCTTGCCTGGG + Intergenic
1185002058 22:48252185-48252207 CAGCCATGTCCTCCTTGCCTGGG + Intergenic
1185002074 22:48252280-48252302 CAGCCATGTCCTCCTTGCCTGGG + Intergenic
1185002085 22:48252334-48252356 CAGCCATGTCCTCCTTGCCTGGG + Intergenic
1185002128 22:48252537-48252559 CAGCCATGTCCTCCTTGCCTGGG + Intergenic
1185002143 22:48252632-48252654 CAGCCATGTCCTCCTTGCCTGGG + Intergenic
1185002154 22:48252686-48252708 CAGCCATGTCCTCCTTGCCTGGG + Intergenic
1185002163 22:48252727-48252749 CAGCCATGTCCTCCTTGCCTGGG + Intergenic
1185002184 22:48252835-48252857 CAGCCATGTCCTCTTTTCCTGGG + Intergenic
1185002223 22:48253025-48253047 CAGCCATGTCCTCCTTGCCTGGG + Intergenic
1185002233 22:48253079-48253101 CAGCCATGTCCTCTTTTCCTGGG + Intergenic
1185039142 22:48495558-48495580 CATCCTTGTTCTCCCTTCCCTGG + Intronic
1185114412 22:48923394-48923416 CGTCCACCTTCTCCTCCCCTTGG - Intergenic
949539577 3:5021375-5021397 CCTCCATCTTTTTCTTTCTTTGG - Intergenic
949590890 3:5492973-5492995 CTTCCCTCCTCTCCCTTCCTAGG + Intergenic
949591367 3:5497464-5497486 CTTCCTTCGTCTCCCTTCCTAGG + Intergenic
949686486 3:6577954-6577976 CATATATCTTCTCCTACCCTTGG + Intergenic
950832205 3:15886033-15886055 CACTCATCTTCTCCTGCCCTTGG + Intergenic
951443848 3:22754048-22754070 CTTTCATCTTGTCCTTTTCTAGG + Intergenic
951489955 3:23258934-23258956 CAAATACCTTCTCCTTTCCTGGG - Intronic
951829318 3:26906823-26906845 TATCCATCTTCTCTTACCCTTGG - Intergenic
951978307 3:28539083-28539105 CATCAGTCTTCTGCTGTCCTTGG + Intergenic
952077303 3:29712752-29712774 TATCCATCTTCTCATGTCCTTGG + Intronic
952226716 3:31384321-31384343 CATCTATATTATCTTTTCCTAGG + Intergenic
952733907 3:36668954-36668976 CATACATCTTCTTCTGTCTTTGG - Intergenic
953316704 3:41934395-41934417 TATCCAGCTTTTTCTTTCCTTGG + Intronic
953621526 3:44536832-44536854 TATTGATCTTCTCCCTTCCTTGG - Intergenic
954160729 3:48719816-48719838 TATCAAACTTCTTCTTTCCTCGG - Intronic
954426668 3:50447039-50447061 CATCCAGCTACACCTTTCCCTGG - Intronic
954982100 3:54755380-54755402 CACCCATCTTTCCCTTTGCTTGG + Intronic
955319663 3:57965218-57965240 CATCCATGGTCTCCTCTTCTTGG + Intergenic
955621565 3:60869808-60869830 CATCCAACTTCTCCCTTTATAGG + Intronic
955868236 3:63408629-63408651 CACCCTTCTTCTCTTGTCCTTGG - Intronic
956097888 3:65736638-65736660 CACCCATCTTCTCCTGCCCTTGG - Intronic
956524374 3:70141353-70141375 CATCCATCTTCTTCTGCCCTTGG - Intergenic
956536185 3:70279759-70279781 CATCCCTCTTTTCCTTCCATGGG + Intergenic
956698763 3:71940542-71940564 CTTCCTTCTCCTCCTTTCCTTGG + Intergenic
956956083 3:74342419-74342441 CATTCTGCTTTTCCTTTCCTTGG - Intronic
957266320 3:77970827-77970849 CATCAGTCTTCTCCTGCCCTTGG + Intergenic
957454845 3:80428250-80428272 CATCCATCTTCACATGCCCTTGG - Intergenic
957640980 3:82852934-82852956 CTTCTATCTTGTCCTGTCCTTGG + Intergenic
957707149 3:83803738-83803760 TATATATCTTCTCCTATCCTGGG - Intergenic
957987841 3:87594253-87594275 CATCCATCTTCTCCTGCACTTGG - Intergenic
958089542 3:88858554-88858576 CATCCTTCTACTCCTTTGCTTGG + Intergenic
958159642 3:89801207-89801229 CATCATTCTTTTCCTTTCTTTGG - Intergenic
958267468 3:91456097-91456119 CATCAGTCTTCTCCTATCCTTGG + Intergenic
958482051 3:94654835-94654857 CATCAGTCTTCTCCTGCCCTCGG + Intergenic
958964163 3:100539647-100539669 CATCCGTCTTCTCCTGCCCTTGG - Intronic
959244066 3:103840954-103840976 CATCCATCTCCTCCTACCTTAGG + Intergenic
959427050 3:106204062-106204084 CATCTATCTTCTCCTGCCCTAGG - Intergenic
959578211 3:107957702-107957724 CCTCCTCCTCCTCCTTTCCTTGG - Intergenic
959737577 3:109677246-109677268 CATCCATCTTTTCCTGACCTTGG - Intergenic
960137230 3:114118212-114118234 CACTCATATTCTCCTGTCCTTGG + Intergenic
960242683 3:115364226-115364248 CATCCATTTTCTCCTGCTCTTGG - Intergenic
960300931 3:116001747-116001769 CTTCCATCTTCACATTCCCTTGG + Intronic
960522802 3:118675152-118675174 CATCAGTCTTCTCCTGTCTTCGG + Intergenic
961008155 3:123418873-123418895 CATCCATCTTCCCCTGCCCTTGG + Intronic
961492804 3:127266921-127266943 TAAGCATCTTCTCCTTTCATTGG + Intergenic
961501763 3:127341179-127341201 AACCCAGCTTCTCCTATCCTAGG + Intergenic
962215103 3:133514355-133514377 CACCCATCTTCTCCTGCCCTTGG + Intergenic
963226334 3:142866289-142866311 CATCCATTTTCTCCTGCCCTCGG + Intronic
963625498 3:147667446-147667468 CACCCATCCTCTGCTGTCCTTGG + Intergenic
963713591 3:148776751-148776773 TACGCATCTTCTCCTGTCCTTGG + Intergenic
963736766 3:149026117-149026139 TTCCCATCTTCACCTTTCCTTGG - Intronic
963788752 3:149561859-149561881 CAGCCCTTTTCTCCTTTCCAGGG - Intronic
963997921 3:151732633-151732655 CATCCATCTTCTCCTGCCCTTGG - Intergenic
964145218 3:153452904-153452926 CATTCATCCTCTCCTGCCCTTGG + Intergenic
964245062 3:154642214-154642236 CCTGCAGCTTCTCCTTTCCTTGG + Intergenic
964733416 3:159891611-159891633 CATAGGGCTTCTCCTTTCCTAGG + Intronic
964805481 3:160605383-160605405 CATCCATCTTCTCCTGTCCTTGG - Intergenic
964958656 3:162394651-162394673 CATTCATCTTCTCCTGCCCTTGG + Intergenic
965138781 3:164808605-164808627 CATCACTCTTCTGCTATCCTGGG - Intergenic
965735688 3:171817868-171817890 CATTCATCTTCTCCTGCCTTAGG - Intergenic
966661701 3:182421756-182421778 CACTCATCTTCTCCTTCTCTTGG + Intergenic
967250440 3:187532284-187532306 CATCCAACTTTTCTCTTCCTGGG - Intergenic
967385577 3:188907679-188907701 CATCTGTCTTCTCCTGTCCTTGG - Intergenic
967758930 3:193202285-193202307 CTTCCATCTTCTCCTTCCCAGGG - Intergenic
967794005 3:193578780-193578802 CACCCATCTTCTCCTATGCTTGG + Intronic
968006874 3:195249109-195249131 CATCCATCGCCTCCTTTTGTGGG + Intronic
968778489 4:2560521-2560543 CTTCCCTCTTCACCTTTCTTTGG + Intronic
969121158 4:4912469-4912491 CGTCCATCTTCTCCTGCCCTTGG + Intergenic
969155330 4:5205110-5205132 CATCCACCTTCTTCTGCCCTTGG + Intronic
969343371 4:6556350-6556372 CATCAGTCTTCTCCTGCCCTGGG + Intronic
969965459 4:10989678-10989700 CATCTATCTTCTCCTGCTCTTGG + Intergenic
970019922 4:11556737-11556759 CATCCATCCTCTCCTGCCCTTGG - Intergenic
970177035 4:13349933-13349955 CATCCATCTTCTCCTGCCCTTGG + Intergenic
970291684 4:14579625-14579647 TATCCATCTTCTTCTGTCCTTGG - Intergenic
970304209 4:14714854-14714876 CACTCATCTTCTCCTTTCAGAGG - Intergenic
970505644 4:16727207-16727229 GATCCATCTTCTAATGTCCTGGG - Intronic
970567195 4:17343242-17343264 CATTTATCTTCTCCCTTTCTTGG - Intergenic
970878327 4:20898107-20898129 CTTCCATCTTCTCCTGCCCTTGG + Intronic
970955744 4:21809269-21809291 CATCCATCTTCTCCTGCTCTTGG + Intronic
970969485 4:21965097-21965119 CATCCAGATTCTCTTTTTCTGGG + Intergenic
971487013 4:27170819-27170841 CATCCATCTTCCCCTGCCCTTGG - Intergenic
971502154 4:27329038-27329060 CATCCATCTTCTCCTGCCCTTGG + Intergenic
971994549 4:33948418-33948440 CATCAATCTTCTCCTGCCCTTGG - Intergenic
972046168 4:34666914-34666936 CATCCATCTTTTTCTGTGCTTGG - Intergenic
972055271 4:34794370-34794392 TATCCATCTTCTCCTGTCCTTGG - Intergenic
972540330 4:40033725-40033747 CACCCATCTTATCCTGCCCTTGG + Intergenic
972712323 4:41609796-41609818 CATCTACATTCTCCTTTCTTGGG - Intronic
972842782 4:42951138-42951160 CATCAAGCTTCTCCTGACCTTGG - Intronic
973932666 4:55808723-55808745 CATCCTTCTTTTCCTTGCTTTGG - Intergenic
973984581 4:56337874-56337896 TATCCATCTGCTCCTGCCCTTGG - Intergenic
974705954 4:65515928-65515950 CATCCATCTTCTCCTGCCCTTGG + Intronic
974770435 4:66404700-66404722 AATCCATCTCCTCCTGCCCTTGG + Intergenic
975051053 4:69865525-69865547 CATCCATCTTCTCTTGCCCTTGG + Intergenic
975241382 4:72064088-72064110 CCTCCATCCTCTTCTGTCCTGGG - Intronic
975455275 4:74583115-74583137 CCTTCGTCTTCTCATTTCCTAGG - Intergenic
975533292 4:75422498-75422520 CATCCATCTTCTCCCTCCCTTGG - Intergenic
976194200 4:82517560-82517582 CACCCATCTTCTACTGCCCTTGG + Intronic
976220765 4:82755157-82755179 TACCCATTTTCTCCTTTCCTGGG - Intronic
976531049 4:86152127-86152149 CATCCATATTCTGATGTCCTTGG + Intronic
976670344 4:87645424-87645446 CATTCTTCTTCTCCTGCCCTTGG - Intergenic
976690277 4:87861537-87861559 CATCCATCTTCCCCTGCCTTGGG + Intergenic
976830997 4:89313546-89313568 CATCCATCTTCTCCTCGCTTTGG - Intergenic
976894789 4:90096618-90096640 CATCACTCTTCTCCTGCCCTTGG - Intergenic
976896079 4:90113493-90113515 CATCCATCTTCCCCACCCCTTGG + Intergenic
977056001 4:92191420-92191442 AATCCATCTTCTCTTGCCCTTGG + Intergenic
977579341 4:98706970-98706992 CACCCATCTTCTCCTGCCCTTGG - Intergenic
977962514 4:103102142-103102164 CATCCATCTTCTCCTGCCCTTGG + Intergenic
978001962 4:103567114-103567136 CATTCAACTTCTCGTTTCCCTGG - Intergenic
978168966 4:105645765-105645787 CCTAGATCTTCCCCTTTCCTGGG - Intronic
978746045 4:112195437-112195459 TTTCCCACTTCTCCTTTCCTGGG - Intergenic
978811026 4:112849997-112850019 CATCTATCTTCTCCTATCCTTGG + Intronic
979005481 4:115289910-115289932 CATTCATCTTCTCCTGCCCTTGG + Intergenic
979903745 4:126257265-126257287 CATCCGTTTTCTCTTTTCATTGG + Intergenic
980383073 4:132051109-132051131 CATGCATCTTCCCCTACCCTTGG + Intergenic
980402749 4:132313819-132313841 CATCCATCTTGTCATGTCCTTGG - Intergenic
980501402 4:133658904-133658926 CATCCATCTTTTCCTGCCTTTGG - Intergenic
980724369 4:136739712-136739734 CATGAATCTTTTCCTGTCCTTGG - Intergenic
980764922 4:137289449-137289471 CATCCATCTTTTTCTGTCCTTGG - Intergenic
980807551 4:137833217-137833239 CATCCATCTTCTCCTGCTTTTGG - Intergenic
981029590 4:140110927-140110949 CATCACTCTTGTCCTTTCATGGG - Intronic
981155227 4:141427164-141427186 CATTCATCTTCTCCTATGCTTGG + Intergenic
981216331 4:142173371-142173393 TATATATCTTCTCTTTTCCTTGG - Intronic
981452844 4:144919215-144919237 CATCCATCTTCTCCTGCTGTAGG - Intergenic
981608722 4:146569277-146569299 CATCCATCTTCTCCTATCCTCGG - Intergenic
981680837 4:147396188-147396210 CATCCATCTCTTCCTGACCTTGG + Intergenic
981722244 4:147813346-147813368 CCTCCCTCTTCTCCTTTTCCTGG + Intronic
981916725 4:150041814-150041836 CATCAATCTTCTCCTGCCCTTGG + Intergenic
982063178 4:151624985-151625007 CAGCCATCTTCTCCCCTCCAAGG - Intronic
982129689 4:152217248-152217270 CATCAGTCTTCTCCTGCCCTTGG - Intergenic
982428550 4:155295932-155295954 CATCAGTCTTCTCCTGCCCTTGG + Intergenic
983454462 4:167945430-167945452 CACCCATCTTCTCCTGCCCTTGG - Intergenic
983841483 4:172462039-172462061 CATCCATCTTCTCTTGTGTTTGG + Intronic
983917404 4:173307570-173307592 CATGCTTCTGCTCCTTTCCTTGG - Intronic
983986126 4:174062266-174062288 CATCCCTCTTCTCCTGACCTGGG + Intergenic
984444188 4:179813044-179813066 CATCCATATTCTCCTGTCGTTGG - Intergenic
984620235 4:181944315-181944337 CATCCATCTTCTCCTTCCCTTGG - Intergenic
984758934 4:183347627-183347649 CATCCATCTTCTTCTGTCCTTGG + Intergenic
984784769 4:183557356-183557378 ACTCCATCTTCTCCTGTCCTTGG + Intergenic
984785989 4:183567682-183567704 CATCCATCTTCTCCTTCTCTTGG - Intergenic
984933666 4:184870596-184870618 CATCCATCTTCTCTTATCCTTGG + Intergenic
985385818 4:189447279-189447301 CATCCTTCTTTTCCTGCCCTTGG + Intergenic
985964895 5:3332409-3332431 GATCCATCTTCTCCTGAACTTGG + Intergenic
986130326 5:4924061-4924083 TATCTGTCTTCTCCTGTCCTCGG + Intergenic
986416058 5:7529451-7529473 CATCAATTTTTACCTTTCCTAGG + Intronic
986999637 5:13647095-13647117 TATCCATCTTCTCCTGTACTTGG - Intergenic
987027255 5:13939964-13939986 CATCCATTTTCTTCTGTCCAGGG + Intronic
987168944 5:15232672-15232694 AATCCATCTTCTATTTTTCTAGG + Intergenic
987306218 5:16640300-16640322 TATTGATCTTCTCCTGTCCTTGG - Intergenic
987382342 5:17296890-17296912 CATCCATCTTCTCTTGCCTTTGG + Intergenic
987386423 5:17334039-17334061 CATCCATCTTCTCCTGCCCTTGG + Intergenic
987615256 5:20266008-20266030 CATCCATCTTCTCCTCCTCTTGG + Intronic
987734567 5:21824213-21824235 TTTTCATCATCTCCTTTCCTGGG + Intronic
988789467 5:34594016-34594038 CATCCATCTTCTCCTGTTCGTGG - Intergenic
989276669 5:39598192-39598214 CATCCATCTCATCCTCTGCTCGG + Intergenic
989824777 5:45839727-45839749 TATCCACCTTCTCCTGGCCTTGG - Intergenic
990029498 5:51239929-51239951 CATTCATCATCTTCATTCCTGGG - Intergenic
990201766 5:53383765-53383787 CATCCATCTTCTCCTGCCTTTGG + Intergenic
990240343 5:53810703-53810725 CATCCATCTTCTCCAGCCCTTGG - Intergenic
990336731 5:54780558-54780580 CATCCATTTTCTTCTGTCCTTGG + Intergenic
990435315 5:55784269-55784291 CACCCTTCTTCTCTTGTCCTTGG - Intronic
991015408 5:61926635-61926657 CATCCACCATCTCCTATCCTTGG + Intergenic
991042586 5:62191354-62191376 AACCCATCTTCTCCTGTCCTTGG + Intergenic
991108981 5:62876240-62876262 CATCGATCTCCTCCTGACCTTGG + Intergenic
991631002 5:68656323-68656345 CCTCCGTCTTCCCCTTTCCCTGG + Intergenic
991716886 5:69459441-69459463 TATCCATCTTCTCCTGCCTTTGG - Intergenic
991950536 5:71943321-71943343 CATCTATTCTCTCCTTGCCTGGG + Intergenic
991989195 5:72320526-72320548 CATCCCTCCCCTCCTTCCCTAGG - Intronic
992030211 5:72713565-72713587 CATCCATCTTCTCCTGTCCTTGG + Intergenic
992110802 5:73491245-73491267 CATCATTCTTCTCCTGTCTTTGG - Intergenic
992120738 5:73589502-73589524 CATCTATCTTCTTCTATCCTTGG - Intergenic
992361979 5:76048301-76048323 CATCCATCTTCTCTTGCCCTCGG - Intergenic
992376993 5:76197980-76198002 CATCCTTCCTCTCCTGTCCTTGG - Intronic
992467880 5:77025054-77025076 CATTGATCTTCTCCTGCCCTTGG + Intergenic
992490482 5:77238818-77238840 CATTCATCTTCTCTTGCCCTTGG - Intronic
993123745 5:83806660-83806682 CATTCATCCTCTTCTGTCCTTGG - Intergenic
993398412 5:87419317-87419339 CATTGATCTTCTCCTGTACTTGG - Intergenic
993469405 5:88288499-88288521 CCTCCATCTTCTCCTACCCTTGG - Intergenic
993535267 5:89076378-89076400 CTTCCACCTTCAGCTTTCCTGGG - Intergenic
993590378 5:89788148-89788170 CATTCATCTTCACCTATCCTTGG + Intergenic
993606425 5:89995716-89995738 CATCCATCTTCTCCTGCCCTTGG + Intergenic
993892636 5:93491709-93491731 CATTCATCTTCTCCTACCCTTGG + Intergenic
994029928 5:95130002-95130024 CATCCATCTTCTCCTGTCCTTGG + Intronic
994073273 5:95624212-95624234 CACCCATCTTCTCTTGTCCTTGG + Intergenic
994271802 5:97786407-97786429 CATCCATTATCTGATTTCCTAGG + Intergenic
994373700 5:98994817-98994839 CATTCTTCCTCTCCTATCCTTGG + Intergenic
994539720 5:101078681-101078703 CATTTATCTTCTCTTGTCCTTGG + Intergenic
995670189 5:114594305-114594327 CATCTATCTGCTCCTCTGCTGGG - Intergenic
995683717 5:114747870-114747892 CATCCATCATTTCCAATCCTGGG + Intergenic
995708507 5:115010935-115010957 CAGCCATGTCCTCCTCTCCTGGG + Intergenic
995844560 5:116480010-116480032 CAAACATCTTCTGCTATCCTGGG - Intronic
997126744 5:131234782-131234804 TATCCATCTTCTGCTGCCCTTGG - Intergenic
997179871 5:131817113-131817135 CATCCATTTTCTCTTGTCCTTGG + Intronic
997254933 5:132421323-132421345 TATCTTTCTTTTCCTTTCCTTGG + Intronic
997801610 5:136868304-136868326 CATCCTTCTTCTTCTGCCCTTGG + Intergenic
997855526 5:137369291-137369313 CATCTATCTACCTCTTTCCTTGG + Intronic
997992201 5:138553935-138553957 CATCCATATTCTTCTAACCTCGG + Intergenic
998325231 5:141274278-141274300 CATCCATCTTCTCCCACCTTTGG - Intergenic
998514991 5:142744718-142744740 CATCCATCTTCTCCTGCCCTTGG + Intergenic
998614024 5:143719848-143719870 CATCCTTCTTCGCATTTCCTGGG + Intergenic
999344703 5:150806195-150806217 CATCCATCTTCTCCCATCCTTGG + Intergenic
999589150 5:153124652-153124674 TTTCCATCTTCTCTTTTTCTTGG - Intergenic
999656467 5:153815507-153815529 CCTCCCTCTTCCCCTCTCCTGGG - Intergenic
999755158 5:154658755-154658777 CACCCATCTTCTCCTTCCCCTGG + Intergenic
1000421463 5:161042760-161042782 CATCTTTCCTCTCCTTCCCTTGG + Intergenic
1000614628 5:163413466-163413488 GATTCATCATCTCCTTTTCTGGG - Intergenic
1001278224 5:170366385-170366407 CAGCCAGCTTCTCCCTTCCAGGG - Intronic
1001280181 5:170381228-170381250 CATCCTTTCTCTCCTGTCCTGGG + Intronic
1001387772 5:171353978-171354000 CATCCAACTTCTCCTGCCCCTGG - Intergenic
1001832756 5:174803335-174803357 CATCCATCTTCTTCTGCCCTTGG + Intergenic
1002671989 5:180875075-180875097 CATCTCCCTTCTGCTTTCCTTGG - Intergenic
1003181040 6:3791969-3791991 CACCCACGGTCTCCTTTCCTGGG - Intergenic
1003343438 6:5243363-5243385 CAACCATATTCTCCTTTCTTAGG + Intronic
1003860891 6:10320789-10320811 CAGCCAATTTCTCCTTCCCTGGG + Intergenic
1004451741 6:15754032-15754054 TATCCATCTTCTTCTCTGCTTGG - Intergenic
1004691960 6:17999825-17999847 CATCAGTCTTCTCCTGCCCTCGG - Intergenic
1005436557 6:25818052-25818074 CATCCTTCTTCACCTTACTTTGG + Intronic
1005498746 6:26411901-26411923 CAGGCATCGCCTCCTTTCCTTGG - Intronic
1005621518 6:27624771-27624793 CATGCATGTTCTCCTGTCATTGG + Intergenic
1005756034 6:28925679-28925701 CCTTCATCTTCTCCTTTACTTGG + Intergenic
1005896659 6:30184945-30184967 CATCCAGGTTCCACTTTCCTAGG - Exonic
1006201565 6:32297175-32297197 CATACATCTTTTCCTTCTCTTGG + Intronic
1006595979 6:35192711-35192733 CAACCAACCTCTCCTTGCCTGGG - Intergenic
1006700918 6:35972453-35972475 CATTCATCTTCTTCATTCCATGG - Intronic
1007172236 6:39871971-39871993 CATCCTTCTTTTCCTGCCCTTGG - Intronic
1007281836 6:40718679-40718701 CATCCATCTTTTCCTGTCCTTGG - Intergenic
1007585439 6:42986263-42986285 CCCCCAGCTTCTCCTCTCCTGGG + Intronic
1008147950 6:47914479-47914501 CATCAATTTTCTCCTATACTTGG + Intronic
1008429901 6:51403627-51403649 CTTGCATCCTCTCATTTCCTGGG + Intergenic
1009034143 6:58096081-58096103 TATCCATCTTCTCCTTCTCTTGG - Intergenic
1009209751 6:60847786-60847808 TATCCATCTTCTCCTTCTCTTGG - Intergenic
1009376401 6:62976098-62976120 CAGCTAAGTTCTCCTTTCCTAGG - Intergenic
1010171016 6:72975538-72975560 CATCTGTCTTCTCTATTCCTTGG + Intronic
1010326027 6:74562620-74562642 CACTCTTCTTCTCCTGTCCTGGG - Intergenic
1010571699 6:77481030-77481052 CATCCCTCTTTCCTTTTCCTTGG - Intergenic
1011061232 6:83271301-83271323 AAACCATTTTCTCTTTTCCTGGG + Intronic
1011109150 6:83817736-83817758 AATCCCTCTTCTCCTTTCCCAGG - Intergenic
1012047216 6:94292671-94292693 CATCCATGTTCTCCTGCCCTTGG + Intergenic
1012121268 6:95370112-95370134 TATCCAACTTCTCCTGTTCTTGG + Intergenic
1012210796 6:96516572-96516594 CAGCCATCTTCTCCTCCTCTCGG + Intergenic
1012378235 6:98588420-98588442 CAGCCTTATTCTCCTTTCCTTGG + Intergenic
1012550666 6:100462374-100462396 TGTCCATCTTTTCCTTTACTTGG - Intronic
1012754233 6:103204345-103204367 CATTCATCTTCTCCTTTTGAGGG - Intergenic
1013178392 6:107697206-107697228 CATGAATCTTCTCCCTTCATGGG - Intergenic
1013462551 6:110389191-110389213 CATCTGTCTTCTCCTGTCCCTGG + Intergenic
1013947435 6:115737687-115737709 CATCCATCTTCTCCCATACTTGG - Intergenic
1013987990 6:116219571-116219593 CATCCATCTCCCTCTTTGCTGGG - Intronic
1014080547 6:117281782-117281804 CACCCATATTCTCCTTCCCTTGG + Intergenic
1014316766 6:119876570-119876592 CATTCATCTTCTCTTGCCCTTGG + Intergenic
1014385406 6:120795002-120795024 CATCCATCCCCTCCTGTCTTTGG - Intergenic
1014715209 6:124856825-124856847 CATCCATCTTCTCCCATCTGGGG + Intergenic
1014895979 6:126899565-126899587 CATCCATCTTCACCTGTCCTAGG + Intergenic
1015119131 6:129682209-129682231 CACCAATATTGTCCTTTCCTTGG - Intronic
1015748281 6:136534324-136534346 CCTCCTTCTTCTTCTTTCCCAGG + Intronic
1015927169 6:138322212-138322234 CATCAATCTTCTCCTGCCCCTGG + Intronic
1016025421 6:139281937-139281959 CATCCATCCACTCCCTACCTTGG + Intronic
1016025834 6:139286170-139286192 CATCCATCCACTCCCTACCTTGG + Intronic
1016119376 6:140328313-140328335 GATACATTTTATCCTTTCCTAGG + Intergenic
1016431376 6:143989513-143989535 CATCAGTCTCCTCCTGTCCTTGG + Intronic
1016551995 6:145291956-145291978 CATCCAGCTTCTCCTGTACTTGG - Intergenic
1016913443 6:149222115-149222137 CAGCCATTTTCTCCTTCCCTTGG + Intronic
1017036476 6:150271763-150271785 GAGCCACCTTCTCCATTCCTTGG - Intergenic
1017516071 6:155156775-155156797 CACCCTTCTGCTCCTTTCTTTGG + Intronic
1017520034 6:155194130-155194152 CATCTACCTTCTCATTCCCTAGG - Intronic
1017702119 6:157084640-157084662 AATACATCTTTTCCTTTCTTAGG + Exonic
1018436530 6:163764546-163764568 CATCATTCGTCTCCTTTCGTGGG + Intergenic
1019022881 6:168933149-168933171 CATCCATCCTTTCCTGCCCTCGG - Intergenic
1019548715 7:1591642-1591664 CATCCATCTCCTCCTGACTTTGG + Intergenic
1019798393 7:3069368-3069390 CATCCATCTTTTCATTTACGAGG - Intergenic
1019854178 7:3587508-3587530 CATCAATCTTCTCCTGTACTTGG - Intronic
1020387174 7:7619515-7619537 CATCCATCTTCTCCTGTTTTTGG - Intergenic
1020718987 7:11717457-11717479 CCTCCATTTTCTGCTTTCCATGG + Intronic
1021057998 7:16074607-16074629 CATCCATCTTTTCCATTTATTGG - Intergenic
1021332353 7:19354558-19354580 CATCCGTCTTCTCCTGTCCTTGG + Intergenic
1021895485 7:25231231-25231253 CAACCAGCTTGTTCTTTCCTTGG - Intergenic
1022331466 7:29383348-29383370 CACCGATCTTCTCCTGCCCTTGG - Intronic
1024286168 7:47759474-47759496 CAACCATTTCCTCCTTTCCTTGG - Intronic
1024519309 7:50290080-50290102 CATCCATCCTCTCCTGCCCTCGG + Intergenic
1024551709 7:50567594-50567616 TATCCATCTTCTCCTGCTCTTGG - Intergenic
1024641552 7:51333264-51333286 AATCCATCTTCTCCTGCCCTTGG - Intergenic
1024642445 7:51341354-51341376 CACCCATATTCTCTTTGCCTTGG + Intergenic
1026161958 7:67877407-67877429 CATCCATCTTCTCCTGCCCTCGG + Intergenic
1026209749 7:68293527-68293549 CTTCAATCTTCTCCTCCCCTTGG + Intergenic
1026210308 7:68298297-68298319 CCTCCATCTTCTCCAATCCTCGG - Intergenic
1026233574 7:68506635-68506657 TATCCATCTTCTTTTTCCCTCGG + Intergenic
1026609058 7:71841136-71841158 CATCCTTCATCTCCTCTCCTAGG - Intronic
1027157661 7:75780095-75780117 CATCCCTTTTCCACTTTCCTGGG + Intronic
1027287868 7:76668418-76668440 CATTCATCTTCTCTTCTTCTTGG + Intergenic
1027382332 7:77624369-77624391 CATTTATCTTCTCATGTCCTAGG + Intronic
1027605973 7:80299295-80299317 CATTCATGTTCTCCTGCCCTTGG + Intergenic
1027705798 7:81531908-81531930 CATCCATCTTCTCCTGACCTTGG - Intergenic
1028210060 7:88062753-88062775 CATGCAACTCCTCCTTTTCTTGG + Intronic
1028303725 7:89234704-89234726 CACCTTTCTCCTCCTTTCCTTGG + Intronic
1028625353 7:92871110-92871132 CTACCATTTTCTCTTTTCCTGGG - Intergenic
1028873371 7:95793311-95793333 CTGCCATCTTGTCTTTTCCTTGG - Intronic
1029089222 7:98035135-98035157 CACCCATCTTCTCCTGCCCTTGG - Intergenic
1029259518 7:99292362-99292384 CCTCCAGCTGCTCCTTTACTAGG - Intergenic
1029953442 7:104611638-104611660 CCTTCATCTTCTCATTTCCAAGG + Intronic
1030332208 7:108283400-108283422 CATTCATCTCTCCCTTTCCTTGG - Intronic
1030580596 7:111350049-111350071 CCTCCATCTTCTGCTTTCAAGGG + Intronic
1030840999 7:114354149-114354171 CATCTATCTTCTCCTTCCCCGGG + Intronic
1031007230 7:116487234-116487256 TTTCCATCTCCTCCTGTCCTAGG - Intronic
1031138813 7:117918729-117918751 CATCCATCTTCTCCTGCCTTTGG - Intergenic
1031561406 7:123243134-123243156 CATCCATCTTCTCTGGCCCTTGG - Intergenic
1031759787 7:125698313-125698335 CATCCACCTTCTCCTGCTCTTGG - Intergenic
1032014195 7:128366589-128366611 CTTCCATCTCCTTCTTTCATGGG - Intergenic
1032015036 7:128373994-128374016 CATCCATCTCCTCATACCCTTGG - Intergenic
1032166296 7:129547676-129547698 CATCCATCTTCTCTTGCCCTTGG - Intergenic
1032951305 7:136917430-136917452 CAACCATCCTCTCCTTTCAGTGG - Intronic
1033721990 7:144070108-144070130 CTGCCATCTGCTCCTGTCCTAGG - Intergenic
1033905997 7:146203644-146203666 CATCCTCTTTCTCCTCTCCTGGG + Intronic
1034071977 7:148194719-148194741 CATCCTTCTTCTCATGCCCTGGG - Intronic
1034553073 7:151833422-151833444 CTTCCACCCTCTCCTTTCCAGGG - Intronic
1034713518 7:153218451-153218473 CATCCATCTTCTCCTGCCCTCGG - Intergenic
1035391257 7:158506557-158506579 CATCCGTCTTCTCCTTGAATGGG + Intronic
1035665606 8:1377588-1377610 CTCCCAGCTTCACCTTTCCTGGG - Intergenic
1036149729 8:6286253-6286275 CATCCATCTTCTCCTGCTCTTGG - Intergenic
1036217373 8:6891966-6891988 CATCCATCCTTTCCTGCCCTGGG + Intergenic
1036484760 8:9169417-9169439 CATCTATCTTACCCTTTACTAGG - Intergenic
1037262398 8:17023486-17023508 CAACCATCTTCTTCTCTCTTGGG - Intergenic
1038323448 8:26550911-26550933 TATCCATTTTCTCCTGCCCTTGG - Intronic
1038381223 8:27096207-27096229 CATCCATGTTCTCCTGCCCTTGG + Intergenic
1039091666 8:33836347-33836369 AATCCATCTTCTCCTGCCCTTGG + Intergenic
1039416011 8:37394575-37394597 CACTCTTTTTCTCCTTTCCTAGG + Intergenic
1039775999 8:40737328-40737350 CATCCCTCTTCTCCTTAAATCGG - Intronic
1040550913 8:48436924-48436946 CATCCATTTTCTCCTGTCCCAGG + Intergenic
1040974124 8:53170948-53170970 CATCACTCTTCTCCTGCCCTTGG + Intergenic
1041224206 8:55682722-55682744 CATCGGTCTTCTCCTGTACTTGG - Intergenic
1042082956 8:65075989-65076011 CATCCTTCCTCTTCTTTCATAGG - Intergenic
1042364313 8:67918948-67918970 CATCCATCTTCTCCTGCCCCCGG + Intergenic
1042538195 8:69880518-69880540 CGTCCACCTTATCCTTTCCTTGG + Intergenic
1043793538 8:84505168-84505190 CATCAATCTGCACCTTACCTCGG + Intronic
1044051360 8:87509773-87509795 CATCAATCTTCTTCTGCCCTTGG + Intronic
1044083996 8:87921210-87921232 CACCCATCTTCTCTTGCCCTTGG + Intergenic
1044359428 8:91264214-91264236 CATGCATCTACAGCTTTCCTTGG + Intronic
1044599600 8:93990700-93990722 CATCCATTTCCTTCCTTCCTTGG - Intergenic
1044605983 8:94047839-94047861 CATCCATATTCTCCTCCCCTGGG + Intergenic
1044611887 8:94099655-94099677 CATTCATCTCCCCCTCTCCTAGG - Intergenic
1044740184 8:95318467-95318489 CATCTATCGTCTCCTGCCCTTGG + Intergenic
1044846733 8:96389339-96389361 CTTCCTTCTTCTCCTTCCCCAGG + Intergenic
1045245184 8:100436413-100436435 CATCCAACTGCTCATTGCCTGGG + Intergenic
1045882260 8:107055174-107055196 CATCTAGCTTCTCCTTTTCCAGG - Intergenic
1045894455 8:107197296-107197318 CATCCATATTCTCCTGCCCTGGG - Intergenic
1045900669 8:107275685-107275707 CATCCATCATGTGCTATCCTAGG - Intronic
1045964195 8:108004567-108004589 CCTCCATCTTCTCCAATTCTTGG + Intronic
1046366621 8:113240156-113240178 CATCCATGTCCTCCTTTCAAAGG + Intronic
1046389050 8:113543740-113543762 CACTCATCTTCTCCTCACCTTGG - Intergenic
1046586597 8:116155756-116155778 CATCCCTCTTAGCCTGTCCTCGG + Intergenic
1046700348 8:117393464-117393486 GATGCATCCTCTCTTTTCCTTGG - Intergenic
1046834923 8:118789626-118789648 CCTCCTACTTCTCTTTTCCTTGG - Intergenic
1046860394 8:119085244-119085266 CATCCATTTTATCATTCCCTTGG - Intronic
1047198878 8:122746882-122746904 CTTCGATCTTCTCCTGCCCTTGG - Intergenic
1047294537 8:123559416-123559438 CATCCACTTCCTCCTTTCTTTGG + Intergenic
1047342147 8:123992586-123992608 CTTCCATCTTCTTCTTTTCTTGG + Intronic
1047509676 8:125506536-125506558 CAGCCATAATCTCCTTTCCAAGG + Intergenic
1047766581 8:127994796-127994818 CATCGATCTTCTCCTGCCCTTGG - Intergenic
1048086596 8:131187180-131187202 AATCCATCTTCTCCTGCTCTTGG - Intergenic
1048106386 8:131414960-131414982 CATCCATCTTCTTCTGTCCTGGG - Intergenic
1048575464 8:135686520-135686542 CGCCCTTCTTCTCCTGTCCTTGG - Intergenic
1048612242 8:136035458-136035480 CATTCATCTTCTCCTGCCCTTGG - Intergenic
1048656017 8:136536703-136536725 CATTCATTTTCTCCTACCCTCGG + Intergenic
1048777125 8:137959547-137959569 CATCCATCTTCTCCTGTTCTTGG + Intergenic
1049312170 8:141938993-141939015 CAACCCACTTCCCCTTTCCTAGG - Intergenic
1050355237 9:4776638-4776660 TAACCATCTTCTCCTGCCCTTGG + Intergenic
1050647215 9:7733066-7733088 CCTCCATCTTCTCTTGCCCTGGG + Intergenic
1050961416 9:11738150-11738172 CATCCATCTTCTCCTGCACTTGG - Intergenic
1050978152 9:11968762-11968784 CACCCTTCTTCTCCTGCCCTTGG + Intergenic
1051135191 9:13912186-13912208 TATCCATCTTCTTCTACCCTTGG - Intergenic
1051440287 9:17075728-17075750 CATCGATCTTCTCCTGCCCTTGG - Intergenic
1051484356 9:17592185-17592207 CTTCCATCTTCTCCTGCCCTTGG - Intronic
1051847726 9:21471131-21471153 CATTTAACTTCTCCTTCCCTAGG + Intergenic
1051863709 9:21654741-21654763 TATCCATCTTCTTCTGTCCTTGG - Intergenic
1052088754 9:24300199-24300221 CAGCTATACTCTCCTTTCCTCGG - Intergenic
1052277588 9:26694671-26694693 AATCCATCTGCTTCTCTCCTAGG + Intergenic
1053430510 9:38038946-38038968 CTTCCATCTCCTCACTTCCTCGG - Intronic
1053655608 9:40215786-40215808 CATCCACCTCCTCTTTTACTTGG + Intergenic
1053905971 9:42845002-42845024 CATCCACCTCCTCTTTTACTTGG + Intergenic
1054367726 9:64362016-64362038 CATCCACCTCCTCTTTTACTTGG + Intergenic
1054528998 9:66160506-66160528 CATCCACCTCCTCTTTTACTTGG - Intergenic
1054675343 9:67851751-67851773 CATCCACCTCCTCTTTTACTTGG + Intergenic
1054852859 9:69866481-69866503 CATCCATTTTCTCTTGACCTTGG - Intronic
1055093957 9:72390945-72390967 CATACGTCTTCTTCTTTTCTTGG - Intergenic
1055409628 9:76015174-76015196 CATCCATCTTCTCCTGCCCTTGG - Intronic
1055851447 9:80635615-80635637 TAGCCATCTTATTCTTTCCTTGG + Intergenic
1056097478 9:83270220-83270242 CACACATCTTCTGCTTTCTTTGG - Intronic
1056544812 9:87604934-87604956 CCTCCATCTTCTCTTTTCAGTGG + Exonic
1056650846 9:88460642-88460664 CATCAGTCTTCTCCTGCCCTTGG - Intronic
1056775065 9:89505901-89505923 CATCTGCCTTCTCCTTTACTCGG + Intergenic
1056808621 9:89747008-89747030 TATGCATCTTCTCCTGCCCTTGG - Intergenic
1057060438 9:91999273-91999295 CACCCTTCTTCTCCTGCCCTTGG + Intergenic
1057073541 9:92121281-92121303 CATCCATGTTCTCCTGCCCCTGG - Intergenic
1057183622 9:93043344-93043366 CATCCATCTTGTCCTGTCCCTGG - Intergenic
1057693034 9:97303571-97303593 CATCCTTCTTCTCCTGCCTTTGG - Intergenic
1057750837 9:97791613-97791635 CATCCATCTTCTTTTATTCTCGG - Intergenic
1058561114 9:106230188-106230210 CATCCATCTTCTCTTAACCTTGG + Intergenic
1058600971 9:106669885-106669907 CATCGATCTTCTCCCTGCCTTGG - Intergenic
1058667541 9:107334295-107334317 CGTCCACTTTCTCCTTTTCTGGG - Intergenic
1058698942 9:107585217-107585239 TATCTATCTTCCCCTTTCATGGG + Intergenic
1059331874 9:113540715-113540737 AATCCATCACCCCCTTTCCTCGG + Intronic
1059981908 9:119782616-119782638 CATCCATTTTTTCCTGTCCTAGG - Intergenic
1061117592 9:128624408-128624430 CATCCAGCTTCGCCTTTCTCTGG - Exonic
1061661733 9:132134815-132134837 CACCCTTCTTCTCTTGTCCTTGG + Intergenic
1061826981 9:133264452-133264474 GACCCATCTTTTCCATTCCTTGG - Intronic
1061939399 9:133875990-133876012 CAGCCATCATCTCCTGCCCTCGG + Intronic
1062017631 9:134299106-134299128 CATCCATCTCTTCCTACCCTTGG + Intergenic
1185913687 X:4010493-4010515 CATCCATTTTCTCTTGCCCTTGG - Intergenic
1185922002 X:4103839-4103861 CATCCATCTTCTCCTGCCCTTGG + Intergenic
1185944188 X:4356173-4356195 TATCCATCTTCTCCTGCCTTTGG + Intergenic
1186159218 X:6759138-6759160 CATACATCTTGTCATTTCATGGG + Intergenic
1186474638 X:9847943-9847965 TCTCCATCTTCCCCTTCCCTGGG - Intronic
1186809498 X:13174410-13174432 CATCCATCTTCTTGTGTCCCTGG + Intergenic
1187060182 X:15779221-15779243 CATCAATCGTCTCCTTTCTTCGG - Intronic
1187273955 X:17802640-17802662 CATCGATCTTCACCTTGCCCTGG - Intronic
1187391836 X:18891171-18891193 CAAACATCTGCTCCTCTCCTCGG + Intergenic
1187955239 X:24511183-24511205 CATCCATTTCTTCCCTTCCTTGG - Intronic
1188362271 X:29270261-29270283 CATCTAGCTGCTCCATTCCTAGG - Intronic
1188439119 X:30197323-30197345 CATCCATCTTCTCCTGCCCTTGG + Intergenic
1188550604 X:31360646-31360668 TATCCATCTCCTCCTCACCTAGG - Intronic
1189372108 X:40436789-40436811 CATCAGTCTTCTCCTGTCCTTGG + Intergenic
1189558385 X:42168198-42168220 CATTCATCTTCTCCTGCCCTTGG + Intergenic
1189567814 X:42261460-42261482 CATCAATCTTCTCCTGCCCTTGG - Intergenic
1189804023 X:44717682-44717704 CATCTATCTTCTCCTGCTCTTGG - Intergenic
1190471166 X:50781048-50781070 CATCCATCTTCTCCTGCCCTTGG - Intronic
1190507130 X:51137261-51137283 CATTCTTCCTCTCCTGTCCTTGG - Intergenic
1190759950 X:53430824-53430846 CATCCCTCCTCTCCCTCCCTTGG - Intronic
1190885042 X:54524246-54524268 CATACATCTTTTTCTGTCCTTGG - Intergenic
1191833129 X:65436349-65436371 CATTCATCTTCTCCTACCTTTGG - Intronic
1191886875 X:65897919-65897941 CACTCATCTTCTCCTGACCTTGG + Intergenic
1193303591 X:79922716-79922738 TATCCATCTCCTCTTTTTCTAGG - Intergenic
1193531046 X:82654990-82655012 GATTCTTCCTCTCCTTTCCTTGG + Intergenic
1194393455 X:93349318-93349340 AATCCAGCTATTCCTTTCCTTGG + Intergenic
1194459141 X:94144526-94144548 CATCCATCTTCTTCTCTCCTTGG + Intergenic
1194934609 X:99933015-99933037 CATCCAACTTATTCTCTCCTAGG - Intergenic
1195134905 X:101895400-101895422 CATTCAGGTTCTCATTTCCTAGG + Intronic
1195153799 X:102101399-102101421 CATCAATCTTCTCCTGCCATTGG - Intergenic
1195792247 X:108600886-108600908 CACCCATCCTCTCCTACCCTTGG - Intronic
1195877801 X:109560523-109560545 GATCCATCTTCTCCTGCCCTTGG + Intergenic
1196093896 X:111777657-111777679 CATCTTTCTACTCTTTTCCTAGG + Intronic
1196821356 X:119703616-119703638 CATTTCTCTTCTCCTGTCCTTGG - Intergenic
1197629469 X:128841867-128841889 CACCCTTCTTCTCCTGCCCTTGG + Intergenic
1197708043 X:129647977-129647999 CCTCTCTCCTCTCCTTTCCTGGG - Intronic
1198012491 X:132572491-132572513 AATCTATCTTCTCCTACCCTTGG - Intergenic
1198512319 X:137364875-137364897 TATACATCTGCTTCTTTCCTGGG + Intergenic
1198798958 X:140430408-140430430 CACCCATTTTCTCCTTCCTTTGG - Intergenic
1198838555 X:140831521-140831543 TATCCATCTTCTCTTGTCCTTGG - Intergenic
1199004586 X:142680294-142680316 CATCCATCTTCTCCTGCCCCTGG - Intergenic
1199373309 X:147077176-147077198 CATCCATGTTCTCCTACACTTGG + Intergenic
1199440387 X:147861425-147861447 CATCCATCTTCTCCTTCCCTAGG + Intergenic
1199461497 X:148090521-148090543 CATTTATCTTCTCCTACCCTTGG + Intergenic
1199566237 X:149218250-149218272 CATCCATCTTCTCCTGCCCTTGG + Intergenic
1199572292 X:149279141-149279163 CATCTGTCTTCTCCTGTCCTGGG + Intergenic
1199579100 X:149343821-149343843 CATCGATCTTCTCCTAACTTCGG + Intergenic
1199664222 X:150083825-150083847 CATCCATTTTCTCCATTCTCTGG + Intergenic
1199825504 X:151494880-151494902 CATTCGTCTTCTCTTGTCCTTGG - Intergenic
1200303546 X:155002526-155002548 CATCTGTCTTCTCCTGCCCTTGG + Intronic
1201153895 Y:11112389-11112411 CATCCACCTCCTCTTTTACTTGG + Intergenic