ID: 1128662297

View in Genome Browser
Species Human (GRCh38)
Location 15:69510966-69510988
Sequence ATCCATCTTCTCCTTTCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128662295_1128662297 -9 Left 1128662295 15:69510952-69510974 CCTTGAGTAGGGACATCCATCTT No data
Right 1128662297 15:69510966-69510988 ATCCATCTTCTCCTTTCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128662297 Original CRISPR ATCCATCTTCTCCTTTCCTC GGG Intergenic
No off target data available for this crispr