ID: 1128662302

View in Genome Browser
Species Human (GRCh38)
Location 15:69511002-69511024
Sequence AGTTCTAAGCCTTTGAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128662298_1128662302 11 Left 1128662298 15:69510968-69510990 CCATCTTCTCCTTTCCTCGGGTA No data
Right 1128662302 15:69511002-69511024 AGTTCTAAGCCTTTGAAATCTGG No data
1128662295_1128662302 27 Left 1128662295 15:69510952-69510974 CCTTGAGTAGGGACATCCATCTT No data
Right 1128662302 15:69511002-69511024 AGTTCTAAGCCTTTGAAATCTGG No data
1128662299_1128662302 2 Left 1128662299 15:69510977-69510999 CCTTTCCTCGGGTATTGAAGCTC No data
Right 1128662302 15:69511002-69511024 AGTTCTAAGCCTTTGAAATCTGG No data
1128662300_1128662302 -3 Left 1128662300 15:69510982-69511004 CCTCGGGTATTGAAGCTCCTAGT No data
Right 1128662302 15:69511002-69511024 AGTTCTAAGCCTTTGAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128662302 Original CRISPR AGTTCTAAGCCTTTGAAATC TGG Intergenic
No off target data available for this crispr