ID: 1128667393

View in Genome Browser
Species Human (GRCh38)
Location 15:69548438-69548460
Sequence CCAATCTGCAAGTCCAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128667393_1128667401 15 Left 1128667393 15:69548438-69548460 CCCTGGTTGGACTTGCAGATTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1128667401 15:69548476-69548498 TATACTACAGGTGCTCATCAAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1128667393_1128667398 3 Left 1128667393 15:69548438-69548460 CCCTGGTTGGACTTGCAGATTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1128667398 15:69548464-69548486 CAGCCCTGGACGTATACTACAGG 0: 1
1: 0
2: 0
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128667393 Original CRISPR CCAATCTGCAAGTCCAACCA GGG (reversed) Intergenic
906002466 1:42438602-42438624 CCACTCTCCAAACCCAACCAAGG + Intronic
911822271 1:102437113-102437135 CCAATCTGCCAGTCCTCCCTTGG - Intergenic
916174952 1:162030443-162030465 CTAATCTGCAAGTCTGACAATGG - Intergenic
917071918 1:171160698-171160720 CCAATCTGAAAGTCTAACATTGG + Intronic
1062887184 10:1025858-1025880 TCAATGTGCAAGTTGAACCAGGG + Exonic
1063936276 10:11081987-11082009 CAAATCTGCAAGTCTCTCCAGGG - Intronic
1067716612 10:48695328-48695350 CAACTATGCAAGTCCAGCCAGGG + Intronic
1071732702 10:88264738-88264760 ACAATCTGTACATCCAACCAAGG - Intergenic
1071808106 10:89146452-89146474 GCAATCTAAATGTCCAACCAAGG + Intergenic
1072451787 10:95544609-95544631 CCAATCTGCAAGACAGCCCAGGG + Intronic
1082088222 11:48067401-48067423 CCTATCTCCAGGTCCTACCAGGG - Intronic
1082981244 11:59124619-59124641 CCAATGTGAAAATCCAAACATGG + Exonic
1084308912 11:68304615-68304637 CCAATCTGTAAGAGCAGCCATGG + Intergenic
1084992501 11:72940648-72940670 CCAGGCTGCAAGGCCAAGCAAGG + Intronic
1089062850 11:115640317-115640339 CCAAGCTGCATTTACAACCAGGG + Intergenic
1096002733 12:48142873-48142895 CCCAGCTGCCAGTCCAGCCATGG - Exonic
1099012911 12:77312972-77312994 CCAATCTGCAACTCCAGACTGGG - Intergenic
1101954493 12:109201342-109201364 TCAATCTGCAAAGCCAGCCAAGG - Intronic
1113518080 13:110918448-110918470 CCAAGCTGCAAGTCTGACCCGGG - Intergenic
1117699455 14:58398178-58398200 CAAATGTGCAAGTGAAACCATGG - Intronic
1118664722 14:68055399-68055421 CAAATCAGCAAGTATAACCAGGG + Intronic
1121855716 14:97268400-97268422 ACAATTTGCAAGTGCAAACAGGG + Intergenic
1125088643 15:35763685-35763707 CAAAACAGCAAGTCCATCCATGG - Intergenic
1127034857 15:54904701-54904723 CCAATCTAAAAGTCCATCAATGG + Intergenic
1128667393 15:69548438-69548460 CCAATCTGCAAGTCCAACCAGGG - Intergenic
1129599862 15:76992426-76992448 CCCATTCGCAAGGCCAACCATGG + Intergenic
1130107943 15:80943045-80943067 CCATTCTGCAAGGCATACCATGG + Exonic
1131688691 15:94802377-94802399 CAAATCTTAGAGTCCAACCAAGG - Intergenic
1132342435 15:101086975-101086997 TCCATCTCCAAGTCCAGCCAAGG + Intergenic
1137489526 16:48919934-48919956 CCAATCTGTAAGCCCCATCAGGG - Intergenic
1139832331 16:69810160-69810182 CCAATGTCCAAGTCCACCCAGGG - Intronic
1141273622 16:82563995-82564017 CCAATCTACATGTCCATCAATGG - Intergenic
1141788107 16:86215179-86215201 CCAACATGCCAGGCCAACCATGG - Intergenic
1150870828 17:68909476-68909498 CCAATTTGCGAGTCCATTCATGG - Intronic
1160546773 18:79662643-79662665 AAAATCTGCAAATCCAGCCAGGG - Intergenic
1161061940 19:2219659-2219681 CCACACTCCAAGTCCAACAAAGG - Intronic
1162022975 19:7876341-7876363 CCAATCTGGAGGTCAAAGCATGG - Intergenic
1164449845 19:28351035-28351057 TCCATCAGCAAGCCCAACCATGG + Intergenic
925975802 2:9141251-9141273 CCAATGAGCAATTCTAACCAGGG + Intergenic
933900115 2:86843663-86843685 CCACTCTGCAAGTGCAGCAATGG - Intronic
935622204 2:105139943-105139965 CCCATTGGCAAGTCCATCCAGGG + Intergenic
935780440 2:106505560-106505582 CCACTCTGCAAGTGCAGCAACGG + Intergenic
937551400 2:123096590-123096612 CCAATTTCAAAGTCCAACCCAGG + Intergenic
938971341 2:136435831-136435853 CGAATGTGCATGTGCAACCATGG + Intergenic
939909442 2:147962620-147962642 CCAATCTGGCAGTCCCACCCAGG + Intronic
940655170 2:156479630-156479652 TAAATCTTCAATTCCAACCAAGG + Intronic
940748497 2:157597354-157597376 CCAACCTGCAAGTCCAGGCAAGG - Intronic
941820574 2:169840507-169840529 CCAACCTGCAACTCCAGCCTGGG - Intronic
943282810 2:185959100-185959122 ACAATCTGCACATCCAACAAAGG - Intergenic
943831943 2:192474215-192474237 TCAATCTTCAAGTACAACAAGGG + Intergenic
945212259 2:207395666-207395688 CCAATCTGCCAGTCCTTCCATGG - Intergenic
1176099291 20:63357653-63357675 CCACTCTGCCCGTCCCACCAGGG - Intronic
1179547181 21:42120730-42120752 CCAGGCTGCAAGCCCAACCCTGG - Intronic
1183169299 22:36173868-36173890 GAAATCTGCAGATCCAACCATGG + Intergenic
1183191129 22:36322658-36322680 CCAGTGTGCGACTCCAACCAAGG + Intronic
950679000 3:14572194-14572216 ACAAACTGAAAGTCCAACCATGG + Intergenic
953202214 3:40787673-40787695 CCAACCTGTGAGACCAACCATGG + Intergenic
956052896 3:65267743-65267765 GGAATCTGCAAGCCCACCCAGGG + Intergenic
961311665 3:126005990-126006012 ATAATCTTCAAGTCCAAGCATGG + Intergenic
961779971 3:129315649-129315671 CCATTCTGCTGGTCGAACCACGG + Exonic
967503040 3:190222371-190222393 CCAAGCTGCAAGTTGACCCAAGG - Intergenic
972020444 4:34306824-34306846 ACAACCTACATGTCCAACCATGG - Intergenic
977767075 4:100811615-100811637 CCAATCTGCAACTCTAAGGATGG - Intronic
978533943 4:109741247-109741269 CAACTCTGCAAGCCCAGCCAGGG - Intronic
979676497 4:123415130-123415152 CCAAACTTCAAGTACAAACAAGG - Intergenic
986601069 5:9473712-9473734 CCCTTCTGCCAGTCCACCCATGG - Intronic
991030362 5:62076181-62076203 CCAATTTGTCAGTCCAACAAAGG - Intergenic
991930841 5:71751138-71751160 CCAGGCTGCAAGCCCTACCAGGG + Intergenic
998046368 5:138990306-138990328 CCAAACAGCAACTCTAACCAGGG + Intronic
999096678 5:148984618-148984640 CCAACCTGAAAGACCAACCTTGG - Intronic
1001094044 5:168762523-168762545 CCGACCTGTAAGTCCAACCTCGG - Exonic
1002895874 6:1379835-1379857 CCAACCTCGAGGTCCAACCAAGG + Intergenic
1006437724 6:34034974-34034996 CCACTCTGCAACTCCAGCCAAGG + Intronic
1007158618 6:39770762-39770784 CCCATCTGCCAGTACATCCAAGG - Intergenic
1007158812 6:39772243-39772265 CCAATCTGCCTGGCCAACCTAGG + Intergenic
1008558567 6:52700514-52700536 TCAATCTCCAATTCCAACAAGGG + Intergenic
1017344303 6:153362042-153362064 AAAATCTGTATGTCCAACCATGG - Intergenic
1021503628 7:21356721-21356743 CTAAACTGCAAGTTCAACAAAGG + Intergenic
1023262125 7:38368584-38368606 CACATTTGCAAGTCCACCCAGGG + Intergenic
1031242460 7:119264339-119264361 CCAATCTGAAAGCCAAAGCAAGG - Intergenic
1033358610 7:140621822-140621844 CCAATCTTCAAGCCCAACTCAGG - Intronic
1038168796 8:25110114-25110136 GCAATGAGCAAGTCCAAGCAGGG + Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1043124236 8:76368699-76368721 CAAATATGCAAGTCCAAATATGG + Intergenic
1045790609 8:105978778-105978800 CCAATCCACAAGTCCACCCTAGG + Intergenic
1047105587 8:121727342-121727364 CCACTGTGCAATTCCAACCTAGG - Intergenic
1048269062 8:133013630-133013652 CCACTCTGCAAACCCAACCTGGG + Exonic
1048440474 8:134455883-134455905 CCAATCCTCTAGTCCAAGCAGGG + Intergenic
1048809961 8:138276743-138276765 CCAGACTGCAAGTGCAACCCTGG - Intronic
1049354988 8:142183166-142183188 CCCATCTGCAAGTCCACTCTAGG - Intergenic
1049912517 9:283148-283170 CCCATCTGGAATTCAAACCAAGG - Intronic
1055551640 9:77437009-77437031 CCAATCTGTAATTCCAACTTGGG + Intronic
1059424601 9:114212879-114212901 CCACTCTGCAACTTAAACCATGG - Intronic
1060412412 9:123408557-123408579 CCAAGCTGTAATTCAAACCAGGG + Intronic
1061150392 9:128824851-128824873 CCAGACTGCAAGACCTACCATGG - Exonic
1186084654 X:5973893-5973915 ACAATCTTCGTGTCCAACCATGG + Intronic
1197878624 X:131139738-131139760 CCATTCTGGAAGTTCATCCAGGG + Intergenic
1198913251 X:141637415-141637437 CCCATCTCCAAATACAACCATGG + Intronic
1199523925 X:148770145-148770167 CTAATCTGCAAGCCACACCAAGG - Intronic
1200210689 X:154345509-154345531 CCACTCTCCAACTGCAACCAGGG - Intergenic
1200220163 X:154386583-154386605 CCACTCTCCAACTGCAACCAGGG + Intergenic
1200297634 X:154938691-154938713 ACAATATGTAAATCCAACCAAGG + Intronic