ID: 1128669026

View in Genome Browser
Species Human (GRCh38)
Location 15:69560484-69560506
Sequence TTGCTGTTATTTTTGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128669026_1128669028 9 Left 1128669026 15:69560484-69560506 CCCTGTCTCAAAAATAACAGCAA No data
Right 1128669028 15:69560516-69560538 CATGATTTTTTGACTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128669026 Original CRISPR TTGCTGTTATTTTTGAGACA GGG (reversed) Intergenic
No off target data available for this crispr