ID: 1128671213

View in Genome Browser
Species Human (GRCh38)
Location 15:69576025-69576047
Sequence CCTTCTGGGAAGTAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128671205_1128671213 8 Left 1128671205 15:69575994-69576016 CCAGGGCTTCAGCATCACACATT No data
Right 1128671213 15:69576025-69576047 CCTTCTGGGAAGTAGATGGAGGG No data
1128671204_1128671213 14 Left 1128671204 15:69575988-69576010 CCTTAGCCAGGGCTTCAGCATCA No data
Right 1128671213 15:69576025-69576047 CCTTCTGGGAAGTAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128671213 Original CRISPR CCTTCTGGGAAGTAGATGGA GGG Intergenic
No off target data available for this crispr