ID: 1128672978

View in Genome Browser
Species Human (GRCh38)
Location 15:69588070-69588092
Sequence AGAGCTCAGCTGAGGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128672978_1128672981 6 Left 1128672978 15:69588070-69588092 CCTCTGGGCCTCAGCTGAGCTCT No data
Right 1128672981 15:69588099-69588121 CATGACTCCCAACCTTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128672978 Original CRISPR AGAGCTCAGCTGAGGCCCAG AGG (reversed) Intergenic
No off target data available for this crispr