ID: 1128673241

View in Genome Browser
Species Human (GRCh38)
Location 15:69590273-69590295
Sequence TGTGGGCTGAGGTCCCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128673241_1128673246 6 Left 1128673241 15:69590273-69590295 CCACTGAGGGACCTCAGCCCACA No data
Right 1128673246 15:69590302-69590324 GTAAACTACTCGTGCACAGCTGG No data
1128673241_1128673247 28 Left 1128673241 15:69590273-69590295 CCACTGAGGGACCTCAGCCCACA No data
Right 1128673247 15:69590324-69590346 GAGATACCATTTATGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128673241 Original CRISPR TGTGGGCTGAGGTCCCTCAG TGG (reversed) Intergenic
No off target data available for this crispr