ID: 1128673246

View in Genome Browser
Species Human (GRCh38)
Location 15:69590302-69590324
Sequence GTAAACTACTCGTGCACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128673241_1128673246 6 Left 1128673241 15:69590273-69590295 CCACTGAGGGACCTCAGCCCACA No data
Right 1128673246 15:69590302-69590324 GTAAACTACTCGTGCACAGCTGG No data
1128673238_1128673246 18 Left 1128673238 15:69590261-69590283 CCCCACTGCAGGCCACTGAGGGA No data
Right 1128673246 15:69590302-69590324 GTAAACTACTCGTGCACAGCTGG No data
1128673240_1128673246 16 Left 1128673240 15:69590263-69590285 CCACTGCAGGCCACTGAGGGACC No data
Right 1128673246 15:69590302-69590324 GTAAACTACTCGTGCACAGCTGG No data
1128673243_1128673246 -5 Left 1128673243 15:69590284-69590306 CCTCAGCCCACATGGCACGTAAA No data
Right 1128673246 15:69590302-69590324 GTAAACTACTCGTGCACAGCTGG No data
1128673239_1128673246 17 Left 1128673239 15:69590262-69590284 CCCACTGCAGGCCACTGAGGGAC No data
Right 1128673246 15:69590302-69590324 GTAAACTACTCGTGCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128673246 Original CRISPR GTAAACTACTCGTGCACAGC TGG Intergenic
No off target data available for this crispr