ID: 1128673247

View in Genome Browser
Species Human (GRCh38)
Location 15:69590324-69590346
Sequence GAGATACCATTTATGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128673241_1128673247 28 Left 1128673241 15:69590273-69590295 CCACTGAGGGACCTCAGCCCACA No data
Right 1128673247 15:69590324-69590346 GAGATACCATTTATGCTCTGTGG No data
1128673244_1128673247 11 Left 1128673244 15:69590290-69590312 CCCACATGGCACGTAAACTACTC No data
Right 1128673247 15:69590324-69590346 GAGATACCATTTATGCTCTGTGG No data
1128673245_1128673247 10 Left 1128673245 15:69590291-69590313 CCACATGGCACGTAAACTACTCG No data
Right 1128673247 15:69590324-69590346 GAGATACCATTTATGCTCTGTGG No data
1128673243_1128673247 17 Left 1128673243 15:69590284-69590306 CCTCAGCCCACATGGCACGTAAA No data
Right 1128673247 15:69590324-69590346 GAGATACCATTTATGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128673247 Original CRISPR GAGATACCATTTATGCTCTG TGG Intergenic
No off target data available for this crispr