ID: 1128673593

View in Genome Browser
Species Human (GRCh38)
Location 15:69593159-69593181
Sequence CTGTTCCAACAGCTGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128673589_1128673593 -1 Left 1128673589 15:69593137-69593159 CCCCTCAGTCAGGAGTCCATTGC No data
Right 1128673593 15:69593159-69593181 CTGTTCCAACAGCTGCAGCCAGG No data
1128673586_1128673593 13 Left 1128673586 15:69593123-69593145 CCAATGGGGTGCCTCCCCTCAGT No data
Right 1128673593 15:69593159-69593181 CTGTTCCAACAGCTGCAGCCAGG No data
1128673590_1128673593 -2 Left 1128673590 15:69593138-69593160 CCCTCAGTCAGGAGTCCATTGCT No data
Right 1128673593 15:69593159-69593181 CTGTTCCAACAGCTGCAGCCAGG No data
1128673591_1128673593 -3 Left 1128673591 15:69593139-69593161 CCTCAGTCAGGAGTCCATTGCTG No data
Right 1128673593 15:69593159-69593181 CTGTTCCAACAGCTGCAGCCAGG No data
1128673588_1128673593 2 Left 1128673588 15:69593134-69593156 CCTCCCCTCAGTCAGGAGTCCAT No data
Right 1128673593 15:69593159-69593181 CTGTTCCAACAGCTGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128673593 Original CRISPR CTGTTCCAACAGCTGCAGCC AGG Intergenic
No off target data available for this crispr