ID: 1128674429

View in Genome Browser
Species Human (GRCh38)
Location 15:69598145-69598167
Sequence CCCTTATGAGGAGGTTGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128674418_1128674429 21 Left 1128674418 15:69598101-69598123 CCTATGGGGGATGCACCAGAGGA No data
Right 1128674429 15:69598145-69598167 CCCTTATGAGGAGGTTGTAGTGG No data
1128674422_1128674429 6 Left 1128674422 15:69598116-69598138 CCAGAGGAGGCAAGGCTGGAATC No data
Right 1128674429 15:69598145-69598167 CCCTTATGAGGAGGTTGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128674429 Original CRISPR CCCTTATGAGGAGGTTGTAG TGG Intergenic
No off target data available for this crispr