ID: 1128675721

View in Genome Browser
Species Human (GRCh38)
Location 15:69607146-69607168
Sequence GTGTTTTCCCTTACATCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128675721 Original CRISPR GTGTTTTCCCTTACATCTTC AGG Intergenic
901252566 1:7791638-7791660 TTCTTTTCCATTGCATCTTCAGG + Intronic
908895076 1:68889210-68889232 GGGTTTTGCCTCACATTTTCTGG + Intergenic
910007583 1:82417534-82417556 GTTTTTCCCCTTTCATTTTCAGG - Intergenic
910828064 1:91430140-91430162 TTGTCTTCCCTTATAGCTTCTGG + Intergenic
911017925 1:93354645-93354667 GTGTTTTCCCTTCTAAGTTCTGG + Intronic
911134262 1:94422386-94422408 CTGTTTTGCCTCACATCATCAGG - Intronic
912212792 1:107573011-107573033 GTGCTTCCCTTTACTTCTTCTGG - Exonic
913340134 1:117750532-117750554 GTGTCTTCCTTTTCATCTTCTGG - Intergenic
917067906 1:171117078-171117100 GTGTTTTCTCTCCCATCTCCAGG + Exonic
924074149 1:240315906-240315928 GTATTTTCCCTTAAATGTGCTGG + Intronic
924767501 1:247047335-247047357 GTGTATTTCCATACATCCTCTGG + Intronic
1062834650 10:627649-627671 GGGGTTTCCCTTACACCTCCCGG - Intronic
1063807579 10:9664222-9664244 AGTTTTTGCCTTACATCTTCTGG + Intergenic
1065074840 10:22066927-22066949 ATGTTTCCCCTTCCAGCTTCTGG - Intergenic
1065475146 10:26128332-26128354 CTGTTTTACATTACCTCTTCAGG + Intronic
1066396187 10:35024527-35024549 CTGCTTTGGCTTACATCTTCAGG + Intronic
1067151048 10:43734884-43734906 TGGTGTTCCCTTACATTTTCTGG - Intergenic
1067159746 10:43815443-43815465 GTCTTTTCCCTTATAGTTTCTGG - Intergenic
1069154671 10:65012745-65012767 GTGTTCCACCTTACATCATCAGG - Intergenic
1069588090 10:69622657-69622679 GTGTTTTGCCTTTCATATTTAGG + Intergenic
1071285661 10:84141833-84141855 CTGTCTTCGCTTACAGCTTCTGG + Intronic
1071726933 10:88208175-88208197 GGGTTTCTCCTTCCATCTTCAGG + Intergenic
1072246175 10:93546082-93546104 GTGCTTTCACATACATTTTCTGG - Intergenic
1073939131 10:108673744-108673766 GTGCTTTACCTTACAACTTGAGG + Intergenic
1074703361 10:116111195-116111217 GTGTTTTGCTTTGCATTTTCAGG + Intronic
1075975789 10:126692909-126692931 GTGGTTTCACTTACATCTCAGGG + Intergenic
1077949612 11:6942003-6942025 TGGTTTTCCCCTACATCTTTTGG - Intronic
1078795564 11:14588942-14588964 TTGCTTATCCTTACATCTTCTGG + Intronic
1079146719 11:17858800-17858822 CTCCTTTCCCTTACTTCTTCAGG - Intronic
1079325087 11:19484783-19484805 GAGTTTTCCCTTACACCTGTGGG - Intronic
1079501167 11:21102737-21102759 GTGTTTTCCGTTCCACCTTTGGG + Intronic
1080260888 11:30348462-30348484 GTGTCATCACTTACATTTTCTGG - Intergenic
1083086740 11:60155674-60155696 GTGTTTTTGCTGACATATTCTGG - Intergenic
1083386354 11:62313134-62313156 CTTATTTCCCTTATATCTTCAGG + Intergenic
1085338942 11:75718822-75718844 GGGTTTTTCCTTTCATCTGCTGG + Intronic
1085441631 11:76569364-76569386 GTGTTTAGCCTTACAGTTTCCGG + Intergenic
1087163089 11:94970116-94970138 GTATTTTCCCTCCAATCTTCTGG - Intronic
1087203463 11:95369330-95369352 GTGTTTTCCTTTATGGCTTCTGG + Intergenic
1088359559 11:108976559-108976581 GGGTTTTCTCTTATTTCTTCTGG + Intergenic
1088583285 11:111335448-111335470 GTGTTTTCCCTTGAATATTCAGG - Intergenic
1089949437 11:122511525-122511547 ATGTTTTCCCAAATATCTTCTGG + Intergenic
1091162038 11:133432623-133432645 GTCTTTTCCCTTTCTTCTTCTGG + Intronic
1091350654 11:134891614-134891636 GTGTTTTCTATTGCATCATCAGG - Intergenic
1097065622 12:56318411-56318433 GGGTTTCCCCTTGAATCTTCAGG + Exonic
1099223117 12:79937072-79937094 GTTTTTTCCCTGACAGCTTCTGG - Intergenic
1100191682 12:92199748-92199770 ATGTTTTCCCCTGAATCTTCAGG + Intergenic
1106792499 13:33169836-33169858 ATGTTATCCTTTTCATCTTCAGG - Intronic
1107850767 13:44570780-44570802 CTGTTGTCACTTGCATCTTCTGG - Intronic
1108299968 13:49063828-49063850 ATGTTTTCCTTTATAGCTTCTGG - Intronic
1110378397 13:74820834-74820856 GTTCTTTCCCTCACATCTTAGGG + Intergenic
1110986698 13:81980012-81980034 CTGATTTCTCTTACATCTTCAGG + Intergenic
1112018522 13:95351564-95351586 GTGGTTTCACTCACATGTTCAGG + Intergenic
1112703617 13:102040328-102040350 TTTTTTTCTCTTACATCTCCAGG + Intronic
1116689337 14:48084687-48084709 GTGTTTTCCTGCACATCTGCTGG + Intergenic
1117639512 14:57783550-57783572 GTATTTTCCCTTCAAACTTCTGG - Intronic
1117853423 14:60000872-60000894 GTCTTTTTCCTTATATATTCTGG - Intronic
1121069582 14:91005433-91005455 GTCTTTTCCATTACATCTACTGG + Intronic
1121984311 14:98487395-98487417 GTTTTCTTCCTTACATTTTCTGG - Intergenic
1124037718 15:26071451-26071473 GTGTTTCCCCTGACGTCTTGTGG - Intergenic
1124091040 15:26600917-26600939 GTGTTTTCCCTGACAATTTATGG - Intronic
1125323503 15:38513015-38513037 GACTTGTCCCTTAAATCTTCTGG - Intronic
1127563686 15:60165814-60165836 CTATTTTCCCCTACATGTTCAGG - Intergenic
1128675721 15:69607146-69607168 GTGTTTTCCCTTACATCTTCAGG + Intergenic
1129000319 15:72327842-72327864 TTGCTTTCCCTTTCCTCTTCAGG + Intronic
1129129390 15:73479265-73479287 GTTTTTTCCCTTTGAGCTTCTGG + Intronic
1131593670 15:93774879-93774901 GTGTTTTCTCTGACAGCCTCTGG + Intergenic
1135299033 16:21309516-21309538 GTGTTTTCACTGACATTTTAGGG + Intergenic
1135660065 16:24288590-24288612 GTCTTTTCCCCTTCATCTTCTGG + Intronic
1137425597 16:48377697-48377719 TTTTTTTTCCTTAAATCTTCAGG - Intronic
1139704577 16:68732370-68732392 GTCTTGTCCCTTTCATCTCCTGG - Intergenic
1140138607 16:72231423-72231445 CTGTTTTCCCTTTAACCTTCAGG - Intergenic
1140282921 16:73571979-73572001 GCATTTTCCCTTAGAACTTCTGG - Intergenic
1140318264 16:73921121-73921143 GAGGTTTTCCTGACATCTTCAGG - Intergenic
1141202418 16:81908262-81908284 CTGTTTTCCCATACCCCTTCGGG + Intronic
1145853685 17:28130740-28130762 GTGTTTTACTTGACATCTTTCGG - Intronic
1147556335 17:41481529-41481551 AAGTTTACCCTTCCATCTTCTGG - Intergenic
1151608803 17:75157346-75157368 GTCTTTTGGCTTACATTTTCAGG + Intronic
1152033695 17:77858868-77858890 ATGTTTTCCCTCACAGCTCCTGG - Intergenic
1154938395 18:21085615-21085637 CTGTTCTCCCTTACATCTTTTGG - Intronic
1156154533 18:34286474-34286496 GAATTTTACCTTACATTTTCTGG - Intergenic
1157907676 18:51584115-51584137 AGGTTTTCCCTTGCATATTCAGG - Intergenic
1158350293 18:56558042-56558064 GTGTTCTCTCTTACATATGCTGG - Intergenic
1161037092 19:2091029-2091051 GGGTTTTCTCTTAGGTCTTCTGG - Intronic
1161896862 19:7089052-7089074 GGGCTTTTCCTTACATGTTCAGG + Intergenic
1165350680 19:35273491-35273513 GTGTTTTCCATCAGCTCTTCAGG + Intronic
1166164997 19:40981103-40981125 GGGTTTTCTCTTGCATCTTCAGG + Intergenic
1168549339 19:57280312-57280334 AGTTTTTCCCTTACATCTACCGG - Intronic
925779449 2:7368561-7368583 GTATTTTACCTTCCATCTTTTGG - Intergenic
925941110 2:8820056-8820078 ATGTTTTCCCATAGTTCTTCTGG + Intronic
929342612 2:40840335-40840357 ATGTTTTCCCTTTCATATTTAGG + Intergenic
929375686 2:41284015-41284037 GTTTTTTCCCTTGCTTTTTCAGG + Intergenic
930402910 2:50913423-50913445 CAGTTTTCCCTTTCATTTTCTGG - Intronic
931304970 2:61019520-61019542 ATGTTTTCTTTTAAATCTTCCGG + Intronic
931331500 2:61290007-61290029 GTCTTTTCCCTTAAATATTATGG - Intronic
933244261 2:79957546-79957568 GTTCTTTCCCATACCTCTTCAGG + Intronic
935170289 2:100606237-100606259 ATGTTTTCCATTATAGCTTCTGG + Intergenic
935476055 2:103526095-103526117 GTGTGTTCTCTTAAATCCTCAGG + Intergenic
936658741 2:114518460-114518482 ATGTTTTCCCTTCTATTTTCAGG + Intronic
937740519 2:125347324-125347346 ATGTTTTCCCTGACATATTGAGG + Intergenic
939096594 2:137839685-137839707 GTCTGTTCCCTCACCTCTTCCGG + Intergenic
939155424 2:138519377-138519399 GTGTTTTCACTTAAAAATTCTGG + Intronic
939495054 2:142917903-142917925 GAGTTTTCTCTTATATCTTAGGG - Intronic
940946182 2:159621125-159621147 TTGTTTTCCCTTATGTATTCTGG - Intergenic
941440068 2:165523627-165523649 TTGATTTCCCTCACATCTTGTGG + Intronic
941723343 2:168835669-168835691 GTGTTTTCCCTTCCAGCATCTGG - Intronic
947392971 2:229658285-229658307 CTGATTTCTCTGACATCTTCAGG - Intronic
1169917511 20:10698321-10698343 GTTTTCTCCCTTGCATGTTCTGG + Intergenic
1170205526 20:13794151-13794173 GTCTTTTCCTTTACAGTTTCTGG + Intronic
1170500117 20:16966882-16966904 GTTTTTTCCCTTGCTTCTTCTGG + Intergenic
1174059081 20:47819639-47819661 ATGTTTTCCCTTAATTATTCAGG + Intergenic
1174282956 20:49452598-49452620 GCCTTTTCCCTTCCATCTTCAGG - Intronic
1174492694 20:50912843-50912865 GTGTTTTTCTTTACAACTTTAGG - Intronic
1176945476 21:14975247-14975269 GTTTTTTTCCATTCATCTTCTGG + Intronic
1177827370 21:26098935-26098957 GTTTTTTCCCTTAACTATTCAGG - Intronic
1180564835 22:16654204-16654226 CAGTTTTCCTTGACATCTTCCGG + Intergenic
1182694485 22:32187464-32187486 GTGTGATGCCTTACAACTTCTGG - Intergenic
1182716814 22:32363643-32363665 GTGTGATGCCTTACAACTTCTGG + Intronic
1182738557 22:32548799-32548821 GTGTCTTCCATTATATCTTTAGG - Intronic
1183801228 22:40166396-40166418 ATGTTTTCCCCTACATTTTTTGG + Intronic
949419146 3:3846599-3846621 GTTTTTTCTCTTAAATCTTTTGG - Exonic
949948967 3:9213399-9213421 GTGTTTCCCCTTTGCTCTTCTGG - Intronic
950458180 3:13104957-13104979 GTGTTTAACCTGAAATCTTCCGG + Intergenic
952832609 3:37577494-37577516 GGGTTTTCCCAGCCATCTTCTGG + Intronic
955489030 3:59464054-59464076 GGGTCTTCCCCTAAATCTTCTGG + Intergenic
955939869 3:64137578-64137600 GTGGTCTCCCTGACATTTTCTGG - Intronic
956461276 3:69475053-69475075 GTGTGTGCCCTTACCTCTTAGGG + Intronic
957239676 3:77642409-77642431 GTGTTTTCAGTTACATATTGAGG - Intronic
963336654 3:143982601-143982623 GTTTTTTCCTTTCCATATTCAGG - Intronic
964897932 3:161620723-161620745 GTATTTTCCCTTACCTAATCTGG - Intergenic
969172334 4:5374163-5374185 GAGTTCTCCCTTAGAACTTCAGG + Intronic
970792822 4:19879448-19879470 ATGTTTTCCTTTCCATCTTGGGG - Intergenic
973168780 4:47112584-47112606 ATGTTTTCCTTTTCATCTTCAGG - Intronic
973274980 4:48297358-48297380 CTGTTTTCCCTTCTATCTCCTGG + Intergenic
974158388 4:58103774-58103796 TTGTTTTCTCTGACATCTTTGGG + Intergenic
974798785 4:66787332-66787354 GTGTTTTCTAGTAGATCTTCTGG + Intergenic
975822814 4:78289180-78289202 GTGTTTTCCTTTACTCCCTCTGG - Intronic
975937124 4:79595590-79595612 TTGTTTTCTCTTTGATCTTCTGG - Intergenic
976946700 4:90779253-90779275 GTGTTCTCTTTTACATATTCAGG + Intronic
976951768 4:90841621-90841643 ATGTTTTCCCTGACATAGTCTGG + Intronic
977503322 4:97868634-97868656 GTGTACTCCTTTACATTTTCTGG + Intronic
979343203 4:119553151-119553173 GTATTTTCTCTCACCTCTTCAGG - Intronic
981896501 4:149807701-149807723 TTTTTTTCCCTTATATATTCTGG - Intergenic
981955454 4:150467000-150467022 GTCTTAACCCTTACATTTTCTGG - Intronic
984285169 4:177719644-177719666 GTGGTTATCCTCACATCTTCTGG + Intergenic
984603599 4:181757786-181757808 GTGTTTGCCCTTTCAGCTGCAGG - Intergenic
984711046 4:182885407-182885429 GTCTTTTGCTTTATATCTTCAGG - Intergenic
987065121 5:14282142-14282164 AAGTTTTCCCTTTCTTCTTCTGG + Intronic
987188615 5:15450773-15450795 CTGTTTTCCCCTCCATCATCTGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
988848779 5:35157705-35157727 GTTTTTTCCCTTGCCTTTTCAGG - Intronic
990469662 5:56103424-56103446 GTGTGTTCCCTTCTATTTTCAGG - Intronic
992578063 5:78140253-78140275 GTGGTTTCCCTTTCCTCTGCAGG + Intronic
994122058 5:96125878-96125900 TTGTTGTCCCTTTCATTTTCAGG + Intergenic
995426085 5:112024392-112024414 GTGTTTTCCCTTAGCTATCCTGG - Intergenic
997048448 5:130349171-130349193 GTCCTTTCCTTTACCTCTTCTGG + Intergenic
997559079 5:134829366-134829388 GAGGTTTCCCTCACAACTTCTGG + Intronic
997931723 5:138078034-138078056 CTGTTTTCCCTTTCAGATTCAGG - Intergenic
998024979 5:138808433-138808455 GTCTTCTCTCTTACATCTTCAGG - Intronic
998089008 5:139351058-139351080 TTGTTTTCCTTTACAGCTTCTGG - Intronic
1000939015 5:167337639-167337661 GAGTTATCCCATTCATCTTCTGG - Intronic
1001034915 5:168291079-168291101 GTGTTTTCCCTGACACCCTCTGG + Intergenic
1004491189 6:16117890-16117912 GTGTTCTCGCTTACATTTTCTGG - Intergenic
1005281344 6:24278130-24278152 CTTTTTTCCCTTTCCTCTTCAGG + Exonic
1006620161 6:35358303-35358325 CTGTTTTCCCTTAGAACCTCTGG + Intronic
1007708549 6:43806488-43806510 TTGTTTTCCCTAACAGCCTCAGG + Intergenic
1009209437 6:60844659-60844681 CTGTTTGCCCTTCCATCTTAGGG - Intergenic
1010439919 6:75881823-75881845 GTGTTTTCCTTTACACCTATAGG + Intronic
1010776650 6:79894247-79894269 CTGTTTCACCTTAGATCTTCAGG - Intergenic
1012542989 6:100383187-100383209 ATGTTTTACCTAACATTTTCAGG - Intergenic
1013754041 6:113440330-113440352 GGATTTTACCTTACATTTTCTGG + Intergenic
1014157045 6:118123248-118123270 CTGTTTTCCTTTAAATCTTCTGG - Intronic
1014495800 6:122120579-122120601 TTGTTTGCCCTAACATTTTCTGG - Intergenic
1016913690 6:149224652-149224674 GTGCTCTCCCTTACCTCTTGTGG - Intronic
1019968084 7:4516967-4516989 GTATTTTCTCTCACTTCTTCTGG - Intergenic
1020632526 7:10656710-10656732 GTATTTTCACTTCCATCCTCAGG + Intergenic
1023190833 7:37580309-37580331 TTTTTTTACCTCACATCTTCAGG - Intergenic
1025235828 7:57234387-57234409 ATGTTTTCCCTTAATTATTCAGG - Intergenic
1027518469 7:79171957-79171979 GTGTATGCCCTTACAGCTTTAGG + Intronic
1028342841 7:89744340-89744362 GTTATTTCCCTTTCCTCTTCAGG - Intergenic
1028364959 7:90018064-90018086 TTGCTTTCACTTACAACTTCAGG + Intergenic
1035260701 7:157659587-157659609 CTTCTTTCCCATACATCTTCAGG + Intronic
1037504083 8:19513306-19513328 GTGTCTTCCGTTACATTTTGCGG - Intronic
1038125032 8:24664102-24664124 ATGTTTTCCCTCTCATTTTCTGG - Intergenic
1039431755 8:37530305-37530327 GTGTTTGCCCTGACATGTGCTGG - Intergenic
1041025713 8:53684059-53684081 GTGTTCTCCCTTCTATTTTCTGG - Intergenic
1042079879 8:65040065-65040087 TTGTTTTACATTACTTCTTCAGG + Intergenic
1042387376 8:68193012-68193034 ATATTTCCCCTTACATTTTCTGG - Intronic
1044228290 8:89744289-89744311 TTGTTTTCTACTACATCTTCAGG + Intergenic
1045950134 8:107842340-107842362 GTTTTTTACCTTGCATCTTTTGG + Intergenic
1047225573 8:122953100-122953122 GTGTTTTCTCTTTGAACTTCTGG - Exonic
1048980049 8:139698349-139698371 GTGTTTTCCCGTGCACCTGCAGG - Intronic
1051148730 9:14058242-14058264 GTTTTTTCCCTTAGATCTGCAGG + Intergenic
1052480570 9:29020119-29020141 GTGTTTTACCTTAAACATTCAGG - Intergenic
1053026190 9:34730268-34730290 GTGTTTTCCAATTCAGCTTCAGG + Intergenic
1055713397 9:79089414-79089436 TTGTTTTCTCTCACATCATCAGG + Intergenic
1055840664 9:80499288-80499310 GTCTTTTCTCTTATAACTTCTGG - Intergenic
1058227561 9:102383949-102383971 GTGTTTTCCCCTCCATCTTCGGG - Intergenic
1186036899 X:5432800-5432822 TTATTTTTCCTTACATTTTCAGG + Intergenic
1186748321 X:12594211-12594233 GTGTTTTCCTTTGTAGCTTCTGG + Intronic
1190947796 X:55112821-55112843 GTGTTTTCCCTAACATCAGGCGG - Intronic
1197445591 X:126549759-126549781 CTGTTTTCCCTTAGATGTTTGGG - Exonic
1199326616 X:146505613-146505635 GTGTTTTCACTTAACTCTTAAGG - Intergenic
1200872548 Y:8118398-8118420 GTATTTTCTCATACATCTTATGG + Intergenic
1200901515 Y:8437137-8437159 GTGTTTTACCTTTCATCCTTTGG - Intergenic