ID: 1128679781

View in Genome Browser
Species Human (GRCh38)
Location 15:69640816-69640838
Sequence TTGAATAAGAGTGGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128679778_1128679781 11 Left 1128679778 15:69640782-69640804 CCTTATTACATTGGCTAACAATT No data
Right 1128679781 15:69640816-69640838 TTGAATAAGAGTGGTGAGGATGG No data
1128679776_1128679781 20 Left 1128679776 15:69640773-69640795 CCTTTCTTGCCTTATTACATTGG No data
Right 1128679781 15:69640816-69640838 TTGAATAAGAGTGGTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128679781 Original CRISPR TTGAATAAGAGTGGTGAGGA TGG Intergenic
No off target data available for this crispr