ID: 1128680628

View in Genome Browser
Species Human (GRCh38)
Location 15:69648797-69648819
Sequence AACTAAGGACAACCCCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128680628_1128680635 29 Left 1128680628 15:69648797-69648819 CCTCTTGGGGGTTGTCCTTAGTT No data
Right 1128680635 15:69648849-69648871 ACCAACAAGAAGATGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128680628 Original CRISPR AACTAAGGACAACCCCCAAG AGG (reversed) Intergenic
No off target data available for this crispr