ID: 1128681841

View in Genome Browser
Species Human (GRCh38)
Location 15:69658089-69658111
Sequence GTGGGTCAAGAGATGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128681841_1128681850 30 Left 1128681841 15:69658089-69658111 CCTGCCTCCATCTCTTGACCCAC No data
Right 1128681850 15:69658142-69658164 AAAACCCAAATCTGCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128681841 Original CRISPR GTGGGTCAAGAGATGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr