ID: 1128682452

View in Genome Browser
Species Human (GRCh38)
Location 15:69661837-69661859
Sequence AACTGATGATAGGATGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128682446_1128682452 20 Left 1128682446 15:69661794-69661816 CCAGTGTTGGGTGGATCTGCAAA No data
Right 1128682452 15:69661837-69661859 AACTGATGATAGGATGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128682452 Original CRISPR AACTGATGATAGGATGAGGG TGG Intergenic
No off target data available for this crispr