ID: 1128683560

View in Genome Browser
Species Human (GRCh38)
Location 15:69668000-69668022
Sequence CTGCATGTCAACATGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128683560_1128683569 18 Left 1128683560 15:69668000-69668022 CCTGGCTCCATGTTGACATGCAG No data
Right 1128683569 15:69668041-69668063 CAATGGTACCCTGGACCTCAGGG No data
1128683560_1128683570 19 Left 1128683560 15:69668000-69668022 CCTGGCTCCATGTTGACATGCAG No data
Right 1128683570 15:69668042-69668064 AATGGTACCCTGGACCTCAGGGG No data
1128683560_1128683566 9 Left 1128683560 15:69668000-69668022 CCTGGCTCCATGTTGACATGCAG No data
Right 1128683566 15:69668032-69668054 AGAGCAAGCCAATGGTACCCTGG No data
1128683560_1128683565 1 Left 1128683560 15:69668000-69668022 CCTGGCTCCATGTTGACATGCAG No data
Right 1128683565 15:69668024-69668046 TACAGGGCAGAGCAAGCCAATGG No data
1128683560_1128683568 17 Left 1128683560 15:69668000-69668022 CCTGGCTCCATGTTGACATGCAG No data
Right 1128683568 15:69668040-69668062 CCAATGGTACCCTGGACCTCAGG No data
1128683560_1128683571 20 Left 1128683560 15:69668000-69668022 CCTGGCTCCATGTTGACATGCAG No data
Right 1128683571 15:69668043-69668065 ATGGTACCCTGGACCTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128683560 Original CRISPR CTGCATGTCAACATGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr