ID: 1128687212

View in Genome Browser
Species Human (GRCh38)
Location 15:69695659-69695681
Sequence GGCCGTCGGGGCAACCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128687212 Original CRISPR GGCCGTCGGGGCAACCTGGA TGG (reversed) Intergenic
902209020 1:14891460-14891482 GGCATTCGCAGCAACCTGGATGG - Intronic
904236994 1:29122656-29122678 GGCCGACGGGGGAGCCGGGAGGG - Intronic
905339596 1:37269298-37269320 GGCATTCGCAGCAACCTGGATGG + Intergenic
906360705 1:45155722-45155744 GGCACTCGCAGCAACCTGGATGG + Intronic
909234415 1:73134264-73134286 GGCCGTCAAAGCAACCTGGATGG - Intergenic
909360922 1:74757748-74757770 GGCCAGTGGGGCAACCTGGTGGG + Intronic
910708071 1:90150797-90150819 GGCATTCGCAGCAACCTGGATGG - Intergenic
916526513 1:165615036-165615058 GGCATTCGCAGCAACCTGGATGG - Intergenic
916669472 1:167001102-167001124 GGCATTCGCAGCAACCTGGATGG + Intronic
916872686 1:168934146-168934168 GGCATTCGTAGCAACCTGGATGG - Intergenic
916966156 1:169945035-169945057 GGCTGCCTGGGCACCCTGGATGG - Intronic
918172719 1:182012774-182012796 GGCATTTGGAGCAACCTGGATGG + Intergenic
919798159 1:201333780-201333802 GCCAGTCAGGGCCACCTGGATGG + Intergenic
920193203 1:204208545-204208567 GGCATTCGCAGCAACCTGGATGG + Intronic
922345721 1:224694777-224694799 GGCCTTTGCGGCAACTTGGATGG + Intronic
922775110 1:228210988-228211010 GCCCCTCAGTGCAACCTGGAGGG + Intronic
924433941 1:244022092-244022114 GGCCGGCGGGGCAGGCAGGATGG - Intergenic
1063170747 10:3507968-3507990 GGCATTTGGAGCAACCTGGATGG + Intergenic
1063544674 10:6969259-6969281 GGCACTCGTAGCAACCTGGATGG + Intergenic
1065410599 10:25423004-25423026 GGCATTCGCAGCAACCTGGATGG - Intronic
1065949562 10:30639740-30639762 GGCATTCGCAGCAACCTGGATGG + Intergenic
1068098931 10:52527647-52527669 GGCATTCGCAGCAACCTGGATGG - Intergenic
1068493791 10:57758554-57758576 GGCATTCGCAGCAACCTGGATGG - Intergenic
1069129032 10:64675809-64675831 GGCATTCGCAGCAACCTGGATGG - Intergenic
1069243302 10:66169328-66169350 GGCATTCAGAGCAACCTGGATGG - Intronic
1069557620 10:69408143-69408165 GACCTTCGGGGGACCCTGGATGG + Intronic
1070337314 10:75467141-75467163 GGCAGTCGGCCCATCCTGGAGGG + Intronic
1071895025 10:90056954-90056976 GGCAGTCACAGCAACCTGGATGG + Intergenic
1073292802 10:102421602-102421624 GGCCGCCGGGGCTGCCCGGAAGG + Intronic
1074058356 10:109942794-109942816 GGCCGTTTGGGCATCCTGGGTGG - Exonic
1076306034 10:129466595-129466617 GGCCGTGGGGGCAGCCTCCAGGG - Intergenic
1077216290 11:1396502-1396524 TGCCCTCGGGCCAGCCTGGAGGG - Intronic
1078103899 11:8346392-8346414 GGGCTTCGGGGGAGCCTGGAGGG + Intergenic
1081578110 11:44332312-44332334 GGCAGTCAGGGCACCCTGGAGGG + Intergenic
1083669577 11:64292399-64292421 GGGCGCGGGGGCACCCTGGAGGG + Intronic
1083796785 11:65021576-65021598 GACCGGCGGGGCTTCCTGGATGG + Intronic
1083920689 11:65780328-65780350 GGCCAGCAGGGAAACCTGGATGG + Exonic
1087405776 11:97728307-97728329 GGCCTTTGCAGCAACCTGGATGG + Intergenic
1087429606 11:98036039-98036061 GGCATTTGTGGCAACCTGGATGG + Intergenic
1088471144 11:110188348-110188370 GGCATTCGCAGCAACCTGGATGG + Intronic
1088825052 11:113487054-113487076 GGCATTCGCAGCAACCTGGATGG + Intergenic
1095962847 12:47846241-47846263 GGCCAGCTGGGCAACCTGAAGGG - Intronic
1098475879 12:70902574-70902596 GGCATTCGCAGCAACCTGGATGG + Intronic
1100989409 12:100235993-100236015 GGCATTCGCAGCAACCTGGATGG - Intronic
1102937526 12:116910392-116910414 GGCATTCGTAGCAACCTGGATGG - Intergenic
1102984379 12:117266409-117266431 GGCATTCGCAGCAACCTGGATGG - Intronic
1103046602 12:117740230-117740252 GGCATTCGCAGCAACCTGGATGG - Intronic
1106060583 13:26287409-26287431 GGCATTCGCAGCAACCTGGATGG + Intronic
1106881001 13:34130236-34130258 GTCCTTCGGGGCCACCTGGATGG - Intergenic
1106973824 13:35180972-35180994 GGCATTCGCAGCAACCTGGATGG - Intronic
1109052586 13:57503663-57503685 GGCATTCGCAGCAACCTGGATGG - Intergenic
1111439812 13:88266396-88266418 GGCATTCGCAGCAACCTGGATGG - Intergenic
1111492600 13:89001941-89001963 GGCATTCGCAGCAACCTGGATGG - Intergenic
1113960232 13:114122116-114122138 GGCCGGCTGCGCAGCCTGGAAGG - Intronic
1114328723 14:21615159-21615181 GGCATTCGCAGCAACCTGGATGG - Intergenic
1115707231 14:36011737-36011759 GGCATTCGCAGCAACCTGGATGG - Intergenic
1115913396 14:38281862-38281884 GGCATTCGCAGCAACCTGGATGG + Intergenic
1117890088 14:60411294-60411316 GGCATTTGTGGCAACCTGGATGG - Intronic
1118142867 14:63103857-63103879 GGCATTCGTAGCAACCTGGATGG - Intergenic
1119091956 14:71791101-71791123 GGCATTCGCAGCAACCTGGATGG - Intergenic
1119644918 14:76341237-76341259 GGCTGTCTGGGCAACGTGGCTGG - Intronic
1120113163 14:80582109-80582131 GGCAGCTGGGGCAACCTGCAGGG - Intronic
1121256416 14:92533557-92533579 GGCATTCGCAGCAACCTGGATGG + Intronic
1121623917 14:95371148-95371170 GGCAGGCAGGGCAGCCTGGACGG - Intergenic
1122331688 14:100921618-100921640 GGCATTCGCAGCAACCTGGATGG - Intergenic
1122387221 14:101357257-101357279 CGCCTTCGGGGCATCGTGGAGGG + Intergenic
1202833155 14_GL000009v2_random:58132-58154 GTGAGTCGGGGCACCCTGGAGGG + Intergenic
1125085823 15:35728065-35728087 GGCGATCTGGGCAACCTGGGAGG + Intergenic
1127090835 15:55465476-55465498 GGCATTCTCGGCAACCTGGATGG + Intronic
1128687212 15:69695659-69695681 GGCCGTCGGGGCAACCTGGATGG - Intergenic
1129643499 15:77408228-77408250 GGCAGTGGCAGCAACCTGGATGG + Intronic
1129882538 15:79016773-79016795 GGCAGTCAGGGGAGCCTGGAAGG + Intronic
1132154872 15:99488578-99488600 GGCCTTCACAGCAACCTGGATGG + Intergenic
1132255607 15:100373601-100373623 GGCTGTCGGGGTGGCCTGGACGG + Intergenic
1135203247 16:20458985-20459007 GGCATTCGCAGCAACCTGGATGG + Intronic
1135215748 16:20565968-20565990 GGCATTCGCAGCAACCTGGATGG - Intronic
1136192175 16:28623102-28623124 GGCCGGGGGGGGAACCTGGGGGG - Intronic
1138594875 16:58024671-58024693 GGCCCTCGGGGCACCCTAGCCGG - Intergenic
1141244888 16:82296642-82296664 GGCATTCGCAGCAACCTGGATGG - Intergenic
1142803135 17:2357455-2357477 GGCATTCGCAGCAACCTGGATGG + Intronic
1143132679 17:4690114-4690136 GGCATTCGCAGCAACCTGGATGG + Intronic
1145268691 17:21392819-21392841 CACGGTCGGGGCAACCTTGATGG + Intronic
1146744609 17:35316348-35316370 GGCCTTTGCAGCAACCTGGATGG - Intergenic
1146820740 17:35982178-35982200 GGCCATGGGGGCACCCAGGAGGG - Intergenic
1147134687 17:38428305-38428327 GGCCGCCGGGGCACCCAGAAGGG + Intergenic
1147157040 17:38549153-38549175 GGCGGTGGGGGCGACTTGGAGGG + Exonic
1147376636 17:40026632-40026654 GGAAGGCGGGGCTACCTGGATGG + Exonic
1147561004 17:41509059-41509081 GGCTGTGGGGGCAGCCTGGTGGG + Intergenic
1148159972 17:45444178-45444200 GCCAGACGGGGGAACCTGGAGGG + Intronic
1148440942 17:47711329-47711351 GGCCGTAGGGGCATGCTGTAGGG - Exonic
1149106088 17:52967212-52967234 GGCATTCGCAGCAACCTGGATGG - Intergenic
1150391262 17:64791057-64791079 GCCAGACGGGGGAACCTGGAGGG + Intergenic
1151079354 17:71310851-71310873 GGCATTCGCAGCAACCTGGATGG + Intergenic
1152609814 17:81310008-81310030 GGCCCTGGGGGCTGCCTGGAGGG - Intergenic
1153530608 18:6042061-6042083 GGCAGTTGGGGAAACCTGTATGG - Intronic
1156643381 18:39129441-39129463 GGCATTCGCAGCAACCTGGATGG + Intergenic
1156782613 18:40869192-40869214 GTCCTTTGGGGCAACATGGATGG - Intergenic
1156894895 18:42234868-42234890 GGCATTTGGAGCAACCTGGATGG + Intergenic
1160970152 19:1764417-1764439 GGCTGGCGGGGAAAGCTGGAGGG + Intronic
1162941556 19:14013219-14013241 GGCATTCGCAGCAACCTGGATGG + Intergenic
1165856006 19:38879596-38879618 GGGGGTTGGGGCAGCCTGGAAGG - Intronic
1167981528 19:53280191-53280213 GGCCTTCACAGCAACCTGGATGG - Intergenic
1167984559 19:53303495-53303517 GGCCTTCGCAGCAACCTGGATGG + Intergenic
930448493 2:51504550-51504572 GGCATTCGCAGCAACCTGGATGG - Intergenic
930469999 2:51800558-51800580 GGCACTCGGAGCAACCTGGTTGG + Intergenic
932654821 2:73601356-73601378 GACGGTCGGGGCTACCTGGCAGG + Exonic
932662974 2:73672970-73672992 GACAGTCGGGGCTACCTGGCAGG + Intergenic
932816654 2:74867213-74867235 GGCATTCGTAGCAACCTGGATGG + Intronic
934104417 2:88682607-88682629 TGCCCTTAGGGCAACCTGGAGGG - Intergenic
938996870 2:136689013-136689035 GGCATTCGCAGCAACCTGGATGG + Intergenic
940003403 2:148989271-148989293 GGCATTCGGAGCAACCTGGGTGG - Intronic
948214276 2:236216959-236216981 GTGCAGCGGGGCAACCTGGAAGG - Intronic
948654339 2:239467129-239467151 GGGCGTGGGGGGAAGCTGGATGG + Intergenic
1170489004 20:16852063-16852085 GGCATTCGCAGCAACCTGGATGG - Intergenic
1171778955 20:29400649-29400671 GGCAGTTGCAGCAACCTGGATGG + Intergenic
1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG + Intronic
1175572766 20:60036696-60036718 GACCATCGGGGCAGCCAGGAGGG - Intergenic
1176235324 20:64051075-64051097 GGCCCGTGGGGCAAACTGGAGGG - Intronic
1176647845 21:9367177-9367199 GTGAGTCGGGGCACCCTGGAGGG - Intergenic
1178842288 21:36147360-36147382 GGGCATCGGGACCACCTGGAGGG + Intergenic
1179463865 21:41557653-41557675 GGCTGCGGAGGCAACCTGGAAGG + Intergenic
1179906277 21:44424844-44424866 GGCTGTCTGGGCCACCTGGAAGG - Exonic
1180189285 21:46154896-46154918 GGCCCTAAGGGCCACCTGGAAGG - Intronic
1181052850 22:20245931-20245953 GGCCGCAGGGCCAACCTGGGTGG - Intronic
1182265896 22:29115122-29115144 GGCATTCGCAGCAACCTGGATGG + Intronic
1184234181 22:43174288-43174310 GGCCCTCGGGGCCACCTGCCCGG + Exonic
1185064311 22:48623141-48623163 CGCCGTCAGGGCATCCTGCAAGG - Intronic
950273575 3:11639519-11639541 GGCCGTGAGGGCACCCAGGACGG + Intronic
950553672 3:13682524-13682546 GGCCTTCATGGCAGCCTGGAAGG + Intergenic
952703637 3:36353189-36353211 GGCCATTGTAGCAACCTGGATGG + Intergenic
952994259 3:38862581-38862603 GGCCTTTGCAGCAACCTGGATGG + Intronic
955257584 3:57349653-57349675 GGCATTCGCAGCAACCTGGATGG + Intronic
957086186 3:75679919-75679941 GGCAGTTGCAGCAACCTGGATGG - Intergenic
958897169 3:99842173-99842195 GGCATTCGTAGCAACCTGGATGG + Intronic
960296602 3:115952407-115952429 GGCATTTGTGGCAACCTGGATGG + Intronic
961061408 3:123832033-123832055 GGCTGTTGGGGCATTCTGGAGGG + Intronic
961144795 3:124584807-124584829 GGGCGGCGGGGCAACATGAAGGG + Intronic
962034922 3:131641846-131641868 GGCATTCGCAGCAACCTGGATGG + Intronic
965869092 3:173244973-173244995 GGCATTCGCAGCAACCTGGATGG - Intergenic
966336868 3:178877903-178877925 GGCATTCGCAGCAACCTGGATGG - Intergenic
966337634 3:178887304-178887326 GGCATTCGCAGCAACCTGGATGG + Intergenic
967439747 3:189492764-189492786 GGCATTCGTAGCAACCTGGATGG + Intergenic
968282740 3:197489456-197489478 GGCCCTCAGGCCAAGCTGGAAGG + Intergenic
1202739039 3_GL000221v1_random:37810-37832 GTGAGTCGGGGCACCCTGGAGGG + Intergenic
969109348 4:4832409-4832431 GGCATTTGCGGCAACCTGGATGG + Intergenic
969496249 4:7527880-7527902 GGCAGTGGGGGCAGCCTGGGGGG + Intronic
969801692 4:9571611-9571633 GGCAGTCATGGCAACCTGGATGG + Intergenic
969881387 4:10177105-10177127 GGCCCTAGGGGCTACCTTGAAGG - Intergenic
973920546 4:55680748-55680770 GGCCTTCACAGCAACCTGGATGG + Intergenic
973933115 4:55813658-55813680 GTCATTCGCGGCAACCTGGATGG + Intergenic
974372604 4:61037232-61037254 GGCCTTCACAGCAACCTGGATGG - Intergenic
977695476 4:99960248-99960270 GGCATTCGCAGCAACCTGGATGG + Intergenic
978426044 4:108583739-108583761 GGCATTCATGGCAACCTGGATGG + Intergenic
978694785 4:111564872-111564894 GGCCGTTGCAGCAACATGGATGG - Intergenic
978947909 4:114520333-114520355 GGCAGTCGCAGCAACCTAGATGG - Intergenic
979661770 4:123264050-123264072 GGCATTCGCAGCAACCTGGATGG + Intronic
981699483 4:147593405-147593427 GGCATTCGCAGCAACCTGGATGG + Intergenic
982459116 4:155646289-155646311 GGCTGTTGCAGCAACCTGGATGG + Intergenic
982768215 4:159371768-159371790 GGCATTCGCAGCAACCTGGATGG + Intergenic
984986590 4:185336471-185336493 GGCCTTCACAGCAACCTGGATGG - Intronic
985443823 4:190007913-190007935 GGCAGTTGCAGCAACCTGGATGG + Intergenic
1202766875 4_GL000008v2_random:155433-155455 GTGAGTCGGGGCACCCTGGAGGG - Intergenic
985688298 5:1293738-1293760 GGCAGGCGGGGCAACCTGCGGGG + Exonic
987291748 5:16514833-16514855 GGCATTCGCAGCAACCTGGATGG - Intronic
987299420 5:16583981-16584003 GGCATTCGCAGCAACCTGGATGG + Intronic
987348060 5:16996528-16996550 GGCATTCGTAGCAACCTGGATGG + Intergenic
989032136 5:37130085-37130107 GGCATTCGCAGCAACCTGGATGG + Intronic
990281017 5:54250731-54250753 GGTCCTGGGGGCAGCCTGGAGGG + Intronic
990602304 5:57371393-57371415 GGCATTCGCAGCAACCTGGATGG - Intergenic
990753250 5:59039995-59040017 AGCGGTCTGGGCAACCTGGAGGG - Intronic
991015755 5:61930396-61930418 GGCATTCGCAGCAACCTGGATGG - Intergenic
992239864 5:74756734-74756756 GGCATTCGCAGCAACCTGGATGG + Intronic
994202292 5:96991213-96991235 GGCAATCGCAGCAACCTGGATGG - Intronic
995940875 5:117582400-117582422 GGCATTCGCAGCAACCTGGATGG - Intergenic
997354510 5:133253691-133253713 GGCAGCAGGGGCAAACTGGAGGG - Intronic
1000360231 5:160440320-160440342 GGCATTCGCGGCAACCCGGATGG - Intergenic
1001256835 5:170190006-170190028 GTCCTTCGCAGCAACCTGGATGG + Intergenic
1001724959 5:173888811-173888833 GACCGAGGGGGCGACCTGGAAGG - Exonic
1002825558 6:770212-770234 GGCATTCACGGCAACCTGGATGG + Intergenic
1002840465 6:900795-900817 TGCCGTCGGGGAAACTTGAATGG + Intergenic
1002848928 6:973977-973999 GGCATTCGCAGCAACCTGGATGG - Intergenic
1003465414 6:6375940-6375962 GGCATTCGCAGCAACCTGGATGG + Intergenic
1004512254 6:16292492-16292514 GGCCTCGGGGGCTACCTGGAAGG - Intronic
1005930338 6:30479255-30479277 GGCATTCGCAGCAACCTGGATGG + Intergenic
1006413785 6:33891682-33891704 GGCTGTCAGTGAAACCTGGATGG + Intergenic
1008655362 6:53606637-53606659 GGCATTCGCAGCAACCTGGATGG - Intronic
1010962228 6:82158401-82158423 GGCATTCGCAGCAACCTGGATGG + Intergenic
1013424156 6:109995609-109995631 GGCATTCGTAGCAACCTGGATGG + Intergenic
1016077156 6:139809721-139809743 GGCCTTTGGAGCAACATGGATGG + Intergenic
1026648472 7:72193799-72193821 GGCATTCGCAGCAACCTGGATGG + Intronic
1027562727 7:79752331-79752353 GGCATTCGCAGCAACCTGGATGG - Intergenic
1029057979 7:97766586-97766608 GGCATTCTCGGCAACCTGGATGG - Intergenic
1033182451 7:139194265-139194287 GGCATTTGGAGCAACCTGGATGG + Intergenic
1034181737 7:149144503-149144525 GCCAGTCAGGGCAACCTGGTGGG - Intronic
1034469707 7:151248707-151248729 GGCCGTCAGGGCAGCCCTGAAGG - Exonic
1035406472 7:158601908-158601930 GGCTGTCTGGGCAACCTTGCTGG - Intergenic
1035460904 7:159038194-159038216 GGAGGTCGGGGCAGCCTGCAGGG - Intronic
1036628497 8:10493317-10493339 GGCAATCGGGGCAATCAGGAAGG - Intergenic
1037687550 8:21156282-21156304 GGCATTTGCGGCAACCTGGATGG + Intergenic
1037879180 8:22564893-22564915 GGGTGGCGGGGGAACCTGGATGG + Intronic
1038425402 8:27461229-27461251 GGCCGTGGGGGCAAAGGGGAGGG - Exonic
1039128433 8:34231371-34231393 GGCATTCGCAGCAACCTGGATGG - Intergenic
1040336616 8:46419294-46419316 AGCCCTGGGGGCTACCTGGATGG - Intergenic
1040571533 8:48615812-48615834 GGCCTTTGCAGCAACCTGGATGG + Intergenic
1042996001 8:74699479-74699501 GGCATTCGCAGCAACCTGGATGG + Intronic
1044292938 8:90493931-90493953 GGCATTTGGAGCAACCTGGATGG + Intergenic
1044947419 8:97402667-97402689 GGCATTCGCAGCAACCTGGATGG - Intergenic
1049641643 8:143718716-143718738 GGCTGGGGGGGCAACCTGGGGGG - Intronic
1050903767 9:10977775-10977797 GGCCTTTGCAGCAACCTGGATGG + Intergenic
1052103462 9:24480485-24480507 GGCATTCGCAGCAACCTGGATGG - Intergenic
1054844338 9:69776681-69776703 GGCATTCGCAGCAACCTGGATGG - Intergenic
1055711805 9:79071611-79071633 GGCTTTCGCAGCAACCTGGATGG - Intergenic
1056626600 9:88258789-88258811 GGGCGTCGGGACAGCCTGCATGG + Intergenic
1058556148 9:106169592-106169614 GGCATTTGCGGCAACCTGGATGG + Intergenic
1058654759 9:107210086-107210108 GGCATTTGCGGCAACCTGGATGG + Intergenic
1058699972 9:107591870-107591892 GGCATTCGCAGCAACCTGGATGG - Intergenic
1059021819 9:110583875-110583897 GGCATTCGCAGCAACCTGGATGG - Intergenic
1059405945 9:114098467-114098489 GGAGGGCGGGGCACCCTGGAGGG + Intronic
1060322646 9:122578642-122578664 GGCATTCACGGCAACCTGGATGG + Intergenic
1203707768 Un_KI270742v1:68254-68276 GTGAGTCGGGGCACCCTGGAGGG + Intergenic
1203547623 Un_KI270743v1:140310-140332 GTGAGTCGGGGCACCCTGGAGGG - Intergenic
1186880494 X:13860933-13860955 GGCATTCGTGGCAACCTGGATGG - Intronic
1187509741 X:19907116-19907138 GGCATTCGTAGCAACCTGGATGG + Intergenic
1188707015 X:33347178-33347200 GGCCTTCGCAGCAACTTGGATGG + Intergenic
1189489775 X:41461321-41461343 GGCATTCGCAGCAACCTGGATGG - Intronic
1190589811 X:51988358-51988380 GGCATTCGCAGCAACCTGGATGG - Intergenic
1190716905 X:53112274-53112296 GGCATTCGCAGCAACCTGGATGG - Intergenic
1193591023 X:83389103-83389125 GGCATTCGCGGCAACCTGGATGG + Intergenic
1193636230 X:83952610-83952632 GGCATTCATGGCAACCTGGATGG + Intergenic
1194104147 X:89747491-89747513 GGCATTCGCAGCAACCTGGATGG - Intergenic
1194224442 X:91238703-91238725 GGCATTCGCAGCAACCTGGATGG - Intergenic
1194469828 X:94279757-94279779 GGCATTCTGAGCAACCTGGATGG - Intergenic
1194630708 X:96279969-96279991 GGCATTCAGAGCAACCTGGATGG + Intergenic
1194866469 X:99074912-99074934 GGCATTCGCTGCAACCTGGATGG + Intergenic
1194878598 X:99221079-99221101 GGCATTTGCGGCAACCTGGATGG + Intergenic
1195237511 X:102916330-102916352 GGCATTCGCAGCAACCTGGATGG + Intergenic
1196518910 X:116649086-116649108 GGCATTCGCAGCAACCTGGATGG - Intergenic
1197048746 X:122032293-122032315 GGCAGTAGCAGCAACCTGGATGG - Intergenic
1200560903 Y:4702065-4702087 GGCATTCGCAGCAACCTGGATGG - Intergenic