ID: 1128687360

View in Genome Browser
Species Human (GRCh38)
Location 15:69696698-69696720
Sequence CTGCATCAGGCACTGTGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128687356_1128687360 -8 Left 1128687356 15:69696683-69696705 CCATGGAGTGCCATGCTGCATCA 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1128687360 15:69696698-69696720 CTGCATCAGGCACTGTGTTTGGG 0: 1
1: 1
2: 1
3: 27
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128687360 Original CRISPR CTGCATCAGGCACTGTGTTT GGG Intergenic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
901435166 1:9243098-9243120 CTGGCTCAGACACTGTGGTTGGG + Intronic
901760428 1:11467669-11467691 CTGCTTCAGGCCATGTGATTTGG - Intergenic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
905477185 1:38237266-38237288 CTGCCTCAGGCTCTGTCTTCTGG - Intergenic
906944667 1:50285507-50285529 ATGCATCAGACCCTGTGTTTGGG - Intergenic
907698265 1:56755968-56755990 CTGAATCAGGCTCTGTTGTTTGG + Intronic
908104671 1:60829080-60829102 CTGGGTCAAGCACTGTGCTTAGG + Intergenic
908768057 1:67571879-67571901 CTGCACCAGGGACCGTGCTTTGG - Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
910376956 1:86582880-86582902 GTTCATCAGGCACTGTGGTTTGG - Intergenic
910555048 1:88522394-88522416 GTGCCTCAAGCACTGAGTTTTGG + Intergenic
911057382 1:93720547-93720569 CTCCATCAGGCGCTGTGGTCTGG - Intronic
911448210 1:98027149-98027171 CTGCTTCAGGCTCTGAATTTGGG - Intergenic
914920176 1:151841108-151841130 ATGCACCAGGCACTGTGCTAGGG + Intergenic
916261532 1:162847148-162847170 CTGATGCAGGCACTGTGCTTGGG - Intronic
917113515 1:171577629-171577651 CTGCAGCAGGTAATGTTTTTAGG + Exonic
917436765 1:175029972-175029994 TTGCATCAGGCCCTGTGTGTGGG - Intergenic
917533450 1:175857125-175857147 CTGCATCAGGCACTATGAGAAGG - Intergenic
919078446 1:192840319-192840341 CTGTGTCAGGCACTGGGTTAAGG - Intergenic
919211981 1:194498510-194498532 CTGTCTGAGGCACTGTGCTTAGG + Intergenic
920585161 1:207152053-207152075 AGGCATAAGGCACTGTGTTAGGG + Intergenic
921345887 1:214184874-214184896 CTGCGTCAGGCACTGTTCTGGGG - Intergenic
923392691 1:233529851-233529873 CTGCATCTGCCCCTGTGTCTTGG + Intergenic
923483124 1:234403278-234403300 GTGCAGAAGACACTGTGTTTGGG - Intronic
924328374 1:242918589-242918611 TTCGATCAGGCACTGTGTGTTGG - Intergenic
1064013451 10:11754890-11754912 CTGAACCAGGCACTGTAATTTGG - Intronic
1066527560 10:36297728-36297750 CTGCAGCAGGCACAGTGCTGGGG + Intergenic
1066612149 10:37260455-37260477 CAGCAGCAGGCCCTCTGTTTAGG + Intronic
1068156652 10:53207185-53207207 CTGCATCATGCAATTTGTTCAGG + Intergenic
1070532243 10:77347166-77347188 CTGTATCAGGCTCTGTGCTAGGG - Intronic
1071841286 10:89474351-89474373 CTGAACCAGGCAGTGTGTTTGGG - Intronic
1072803960 10:98412446-98412468 CTGCATCAGGCAGTGTTGGTTGG + Intronic
1073616574 10:105002457-105002479 CTGCATCAGGCACTGAGCCGGGG + Intronic
1073893457 10:108126032-108126054 ATGTATAAGGCTCTGTGTTTGGG - Intergenic
1074887695 10:117707319-117707341 CTTCTTGAGGCACTGTCTTTTGG - Intergenic
1075194250 10:120341316-120341338 CTGCAGAAGGCAATGTGTTAGGG + Intergenic
1075955275 10:126518107-126518129 CTGCCTCAGGCTCTGCCTTTTGG + Intronic
1076043739 10:127274116-127274138 CTTCATCATGCACTTTTTTTGGG - Intronic
1077388237 11:2285815-2285837 CTGCGTCGGGCAGTGTGTTGGGG + Intergenic
1077584608 11:3441039-3441061 CTGCCTCAGGCTCTGCTTTTAGG + Intergenic
1077726061 11:4676145-4676167 CTGTCTCAGGCACTGCTTTTAGG + Intergenic
1082887923 11:58108004-58108026 ATGAGGCAGGCACTGTGTTTAGG + Intronic
1084241504 11:67823688-67823710 CTGCCTCAGGCTCTGTTTTTAGG + Intergenic
1084267634 11:68013042-68013064 CTGAATCAGGCACTGGGCTGGGG - Intronic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1088765357 11:112970246-112970268 CTGCCTCAGGCTCTATGTTTGGG + Intronic
1091099337 11:132855702-132855724 CTGCCTCAGGCACTCTGATGAGG - Intronic
1091412201 12:250853-250875 CTGCGCCAGGCCCTGTTTTTAGG - Intronic
1093205851 12:16248153-16248175 CTGAATCAGGAGTTGTGTTTTGG + Intronic
1093224691 12:16467790-16467812 CTGAAGCAGACACTCTGTTTGGG - Intronic
1093647082 12:21599253-21599275 CTGCTTCTGCAACTGTGTTTTGG - Intronic
1094433403 12:30395387-30395409 CTGCATCTGGCCTTGTGGTTGGG - Intergenic
1094581331 12:31736522-31736544 CTGAATCAGACAGTTTGTTTGGG - Intergenic
1095164551 12:38956408-38956430 CTGCATCAGATACTTTGTGTAGG + Intergenic
1095555654 12:43500778-43500800 CTGTATCATATACTGTGTTTAGG + Intronic
1096444287 12:51674750-51674772 CTGTACCAGCCACTGTGTTAAGG + Intronic
1096533788 12:52258227-52258249 CTGCTTCACGCACTGTGCGTTGG + Intronic
1096550173 12:52367043-52367065 CTGCTTCACGCACTGTGCGTTGG + Exonic
1096715504 12:53488702-53488724 CTGAATCTGGCACGGTGTGTTGG + Intronic
1098772635 12:74573560-74573582 CTGAATTAGAAACTGTGTTTGGG - Intergenic
1099453812 12:82840159-82840181 GTGCGTCATGCACTGTGCTTTGG + Intronic
1100379556 12:94048919-94048941 CTACTTAAGGCACTCTGTTTTGG + Intergenic
1101007423 12:100414719-100414741 ATGCATCTGGCACTGTGCTAAGG - Intronic
1104752221 12:131246964-131246986 TTGCATCCGGGACTGTGTCTGGG - Intergenic
1105883105 13:24620830-24620852 CTGCACAAGGCACTGTGGTGCGG - Intergenic
1107114136 13:36728200-36728222 CTGTACCAGGCACTGTGTCAGGG - Intergenic
1107197305 13:37667942-37667964 CTGTGTCAGGCACTGTCTTCGGG + Intronic
1107715494 13:43195458-43195480 CTGCATCAGGGACACTGTTCTGG + Intergenic
1111750593 13:92326860-92326882 CTGCATCAGGCTCTATGGTCAGG + Intronic
1114429532 14:22648509-22648531 TTGGATCAGTCACTGTGGTTGGG - Intergenic
1115249772 14:31333013-31333035 CTGCATCAGGCTCAATGTTGTGG - Intronic
1117016601 14:51524802-51524824 TTGCATCAATCACTGAGTTTTGG - Intronic
1119234608 14:73009052-73009074 TTGCGTCAGGCACTGTGCTAAGG - Intronic
1119922811 14:78462084-78462106 CTGCAACAGGCATTGTGCTTGGG - Intronic
1120716674 14:87848059-87848081 ATGCATCAGACACTGTGCCTGGG + Intronic
1121521908 14:94591881-94591903 CTGCCCCAGGCACTGTGCTGGGG - Intronic
1124340640 15:28887244-28887266 TTGCGTCTGGCACTGTTTTTGGG + Intronic
1126135197 15:45383076-45383098 CTGTGTCAGGCACTGTGCTAGGG - Intronic
1126885240 15:53142076-53142098 GTGCATCAAGGACTGTGTTGGGG + Intergenic
1127391380 15:58507672-58507694 CTCCACCAGGCACTGTGTAGAGG + Intronic
1127607561 15:60603786-60603808 CTTCAGCAAGCACTGTGCTTGGG + Intronic
1128687360 15:69696698-69696720 CTGCATCAGGCACTGTGTTTGGG + Intergenic
1129737105 15:77972643-77972665 GTCCATCAGGCCCTGTGTGTGGG + Intergenic
1129848975 15:78780992-78781014 GTCCATCAGGCCCTGTGTGTGGG - Intronic
1130403748 15:83580218-83580240 CTGCATGAGGAGCTGTGCTTCGG + Intronic
1130519149 15:84649032-84649054 CTGTGTCAGGCGCAGTGTTTAGG + Intronic
1133346299 16:5072856-5072878 CTGAATCACGGACAGTGTTTTGG - Intronic
1133353002 16:5114633-5114655 CTGCCTCAGGCTCTGTTTTTAGG + Intergenic
1134230422 16:12424793-12424815 ATGGATCAGACACTGTGTTAAGG + Intronic
1134886354 16:17796094-17796116 CTGCATCAGGCATTGTGCCAAGG - Intergenic
1135950737 16:26911764-26911786 ATGTGTTAGGCACTGTGTTTGGG - Intergenic
1137584771 16:49657776-49657798 TTGCTTCAGGCTCTGTGTTCAGG + Intronic
1137830443 16:51538701-51538723 CTGCCTCTGGGACAGTGTTTGGG + Intergenic
1137855348 16:51789419-51789441 CTTCAGCAGGCACTGTGGTCGGG - Intergenic
1138472528 16:57249471-57249493 CTGCATCCTGCACTGGGTTGTGG + Intronic
1139007091 16:62586262-62586284 CTACATCTGGCCTTGTGTTTGGG + Intergenic
1139162609 16:64529244-64529266 CTGTATCAGGTATTGTGTTTAGG - Intergenic
1139915356 16:70424931-70424953 CTGGACCAGGCACTGTGGCTGGG + Intronic
1139955589 16:70691559-70691581 CTGCATCAGGTGCTGTCTTCTGG + Intronic
1143472776 17:7186269-7186291 ATGCGTCAGGCACTGTGCTGAGG + Intergenic
1143687817 17:8533176-8533198 GTGAAACAGGCAGTGTGTTTTGG - Intronic
1144254120 17:13448783-13448805 CTGAATAATGCACTGAGTTTGGG + Intergenic
1144707068 17:17376630-17376652 CTGCACCAGGCTCTGTGCTAGGG - Intergenic
1145288338 17:21522946-21522968 CTTCATCATCCACTGTGCTTGGG + Intergenic
1145913370 17:28555551-28555573 CTGCCTGAGGCTCTGTGTTGAGG - Intronic
1146649122 17:34595837-34595859 CTTCTTCAGGGACTGTATTTGGG + Intronic
1146905697 17:36616505-36616527 CTGGGTCAGGCACTGTGCATGGG + Intergenic
1148862125 17:50609927-50609949 CTGCGTCAGGTACTGCGTCTGGG + Exonic
1150196691 17:63306094-63306116 CTGCCTCAGTCACTCCGTTTTGG - Intronic
1152108827 17:78345879-78345901 CTGCTTTAGGCACTGTGGTGAGG - Intergenic
1156606199 18:38670302-38670324 CTGCTTAGGGCACGGTGTTTAGG - Intergenic
1157202600 18:45671870-45671892 CAGCCACAGGGACTGTGTTTTGG - Intronic
1157579900 18:48767812-48767834 CATCATCAAGCATTGTGTTTTGG + Intronic
1158094241 18:53752949-53752971 CTGCATCAGGAATTGGGTATGGG - Intergenic
1158775652 18:60575416-60575438 ATGAATCAGGCACTGTGCTGAGG + Intergenic
1161115016 19:2491907-2491929 CTGCATGAGGGCCTGTGTGTGGG - Intergenic
1161616065 19:5270924-5270946 CTCCCTCAGGCCCTGTGCTTTGG - Intronic
1164150461 19:22545997-22546019 CTCCATGAGGCTCTGTGGTTGGG + Intergenic
1165798509 19:38533084-38533106 CTGGGTCAGGCACCTTGTTTGGG - Intronic
1167246443 19:48375928-48375950 CAGCATCAGGGCCTGTGCTTTGG + Intronic
1167883458 19:52481614-52481636 CTGCATAAGTCACTGTCCTTGGG - Intronic
1168095327 19:54111204-54111226 CTGCTTCAGCCACTGTCTTTGGG - Intronic
925141042 2:1550102-1550124 CTCCATCAGGCCCTGGCTTTGGG + Intergenic
925833622 2:7920534-7920556 ATGCATCAGGCACTGTTCCTGGG - Intergenic
927388235 2:22561496-22561518 CTGCACCAGGCACTGTGGTACGG + Intergenic
927388840 2:22569433-22569455 CAGCATGAGGCACTTTGTTATGG + Intergenic
927445666 2:23159051-23159073 GTGAATCTGGCACTGTGTTATGG - Intergenic
928261058 2:29767115-29767137 ATGCACCAGGCACTGTGATCAGG + Intronic
928277290 2:29914543-29914565 TTGCATCAGGCATTGGGTTAAGG + Intronic
929164411 2:38866640-38866662 ATGCACCAGGCACTGTTTTAGGG - Intronic
931905479 2:66838227-66838249 CACCATCAGGCACTGAGTGTTGG - Intergenic
933051670 2:77609859-77609881 CTGGAGGAGGCACTGTGATTAGG + Intergenic
934490863 2:94761336-94761358 CAGCATCAGGAACTCTGTTCTGG + Intergenic
935421136 2:102870351-102870373 CTCCATCTGGTACTGTGTTTTGG - Intergenic
937452171 2:122010687-122010709 CTGGATCAGTCACTGGGTGTGGG + Intergenic
938278784 2:130050485-130050507 CAGCATCAGGAACTCTGTTCTGG + Intergenic
938329758 2:130441344-130441366 CAGCATCAGGAACTCTGTTCTGG + Intergenic
938360188 2:130680159-130680181 CAGCATCAGGAACTCTGTTCTGG - Intergenic
938436591 2:131286867-131286889 CAGCATCAGGAACTCTGTTCTGG - Intronic
938964900 2:136379748-136379770 CTGCTCCAGGGACTGTGTTTTGG + Intergenic
939462982 2:142521208-142521230 GTGTGTCAGGCACTGTTTTTTGG - Intergenic
940825227 2:158404103-158404125 CTATACCAGGCACTGTGTTAAGG - Intronic
941116656 2:161480069-161480091 CTTCATCAGGCCCTGGGTATGGG - Intronic
941886727 2:170535735-170535757 TTCCATCAGGCACTGTGCTGAGG - Intronic
941891692 2:170588819-170588841 CTGCATCAGGAACCTTGCTTGGG + Intronic
941948813 2:171131442-171131464 TTGCATCTGCCACTCTGTTTTGG - Intronic
943045328 2:182854344-182854366 CTGCTTCATGCACTCTGTTCAGG - Intronic
944006736 2:194918123-194918145 TTGCATCAGGCACTGTAATGTGG + Intergenic
944585767 2:201172158-201172180 CTTCATCAGGTAAAGTGTTTAGG - Exonic
945477717 2:210305074-210305096 CTGCTTCAGCAACTGTTTTTAGG + Intronic
945492375 2:210471602-210471624 CCGCTTCAGGCATTGTATTTTGG + Intronic
946031813 2:216711373-216711395 CTGCCTCAGTCACTGTCTTCAGG + Intergenic
946289617 2:218734369-218734391 GTGTATCAGTCACTGTGTTGGGG + Intronic
946504254 2:220282056-220282078 CTGCATCCATGACTGTGTTTGGG + Intergenic
1169772951 20:9221279-9221301 CTGCATCAGTCACTGACTGTGGG + Intronic
1170291631 20:14776430-14776452 GTGTATCAGGCACTGTATTGAGG - Intronic
1172852979 20:37979979-37980001 CTTCAGAAGGCACTGTGTTGTGG - Intergenic
1173020856 20:39267022-39267044 CTCCAGCAGACCCTGTGTTTGGG - Intergenic
1173391156 20:42634967-42634989 GTGTTTCAGGCACTGTGCTTGGG - Intronic
1173928763 20:46800673-46800695 CTGCATCAGGCACTGGGGAGGGG - Intergenic
1174037544 20:47677526-47677548 CAGCATCAGGCGCAGTGGTTTGG + Intronic
1174961658 20:55164540-55164562 CAGCCTCAGGTACTGTGTTATGG - Intergenic
1175217449 20:57399046-57399068 CTGCAGAAAGCACTGTGATTAGG - Intronic
1178705257 21:34867873-34867895 ATCCATCAGGCTGTGTGTTTGGG + Intronic
1181735803 22:24880644-24880666 CTGCATTAGGCACTGTGGATGGG - Intronic
1182568975 22:31221853-31221875 ATGCATCTGACACTGTGTTGGGG - Intronic
1183298380 22:37045537-37045559 TTGCATCAGGCACTGATCTTGGG + Intergenic
1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG + Intergenic
1184178445 22:42803280-42803302 CTGCATCAGGCAGTCTGGTTTGG - Intronic
949867896 3:8561807-8561829 CTGCATCCAGCACTGTGCTCAGG - Intronic
950128470 3:10526043-10526065 GTGCACCAGGCACTGTGTTAAGG - Intronic
951995917 3:28728458-28728480 GTGCATCAGGCACTGTGTTCAGG + Intergenic
952165441 3:30743789-30743811 CTACAGCAGGCCCTGTGTGTGGG - Intronic
952461916 3:33536462-33536484 CTGCTTCAGGATCTGTGTATTGG - Intronic
952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG + Intergenic
953043805 3:39277915-39277937 ATGGGTCAGGCAGTGTGTTTGGG + Intronic
954700285 3:52447247-52447269 CTGTGTCAGGCCCTGTGTTGGGG + Intergenic
955066336 3:55536458-55536480 CTGTATCAGGCACAGTGCTAGGG - Intronic
955220979 3:57023190-57023212 GTGCATCTGGGACTGTGTTTGGG - Intronic
956032356 3:65052333-65052355 CTCCCTCAGGCTCTGTGGTTAGG - Intergenic
956374354 3:68598326-68598348 CTGCACCAGTCACTGTGGCTAGG - Intergenic
956450499 3:69370305-69370327 CTGCACCCGGCCCTGTGGTTGGG - Intronic
956836752 3:73102005-73102027 CTGCAGCTGGCACTGGGATTGGG + Intergenic
957056981 3:75450596-75450618 CTGCCTCAGGCTCTGCTTTTAGG + Intergenic
957290631 3:78273353-78273375 CTGAATCAAGCACTGTGTCCAGG - Intergenic
959663632 3:108897188-108897210 CTGTATCAGCCACTGTGCCTAGG - Intergenic
960901491 3:122558567-122558589 CTGCTCAAAGCACTGTGTTTGGG + Intronic
961085194 3:124061075-124061097 CTTCAGAAGGCCCTGTGTTTGGG - Intergenic
961296492 3:125889120-125889142 GTGCCTCAGGCTCTGTTTTTCGG - Intergenic
961507440 3:127379384-127379406 CTGTACCAGGCTCTGGGTTTGGG - Intergenic
961935458 3:130578371-130578393 CTGCTTCAGGCTCTGTTTTCTGG - Intronic
962050701 3:131811781-131811803 TTGTGTCAGGCACTGTGTTAAGG + Intronic
962688306 3:137868546-137868568 CTCCTTCAGGCACTGTCTCTGGG - Intergenic
963072801 3:141318902-141318924 CTGCATTAGGGACTCTGTGTGGG + Intergenic
963336861 3:143985111-143985133 AGGCAACAGGCACTGTGTTACGG - Intronic
965341122 3:167492566-167492588 GGGTATCAGGCACTGTGCTTAGG + Intronic
966414303 3:179673347-179673369 CTGTAGCAGGTACTGTTTTTGGG + Intronic
967229130 3:187320919-187320941 CTGGGTCAGGCTCTGTGTCTGGG + Intergenic
968999794 4:3970885-3970907 CTGCCTCAGGCTCTGCTTTTAGG + Intergenic
969129135 4:4978348-4978370 TTGCGCCAGTCACTGTGTTTGGG + Intergenic
969130722 4:4989442-4989464 CTGCATGATGCACTGTGCATTGG + Intergenic
969614939 4:8246847-8246869 CTTCTTCAGGAAATGTGTTTTGG + Intergenic
969754213 4:9137750-9137772 CTGCCTCAGGCTCTGCTTTTAGG - Intergenic
969814109 4:9674026-9674048 CTGCCTCAGGCTCTGCTTTTAGG - Intergenic
970218888 4:13787012-13787034 ATGCATCAGGCACTGCATTAGGG + Intergenic
970554194 4:17215027-17215049 CTGCAGCAGGGACTCTGTGTGGG + Intergenic
971885437 4:32440205-32440227 TTGCATCAGGCCCTTTGTATTGG + Intergenic
972648495 4:40992827-40992849 CTCCATCCGGCCCTGTGGTTTGG - Intronic
974782484 4:66571461-66571483 CTGCATCTGGCTCTCTGCTTTGG + Intergenic
976959984 4:90958519-90958541 CTGGAGCAGGCTGTGTGTTTTGG + Intronic
977807572 4:101320754-101320776 CTGGATCAGGCAATGTGTCCAGG - Intronic
978178172 4:105760081-105760103 CTGCATAAGACACAGTTTTTTGG - Intronic
978327532 4:107576196-107576218 CTGCATCAAGCCCTATGCTTTGG - Intergenic
978417456 4:108491573-108491595 CTGCATCAAGCCCTGAGATTTGG + Intergenic
978479421 4:109172195-109172217 TTGCACCAGGCACTGTGCTAAGG + Intronic
978865297 4:113500945-113500967 TTGCGTCAGGCACTATGTTAAGG + Intronic
979948111 4:126859916-126859938 CTGCATGGGGCCCTTTGTTTTGG - Intergenic
983569356 4:169187924-169187946 CTTCATCAGGCATTGGATTTAGG - Intronic
984559180 4:181248437-181248459 TTGCATAAAGCACTGTGTATGGG + Intergenic
986532165 5:8749083-8749105 CTGCTTTATGCAGTGTGTTTGGG + Intergenic
986619938 5:9661879-9661901 CTGTTTCAGGCACTAAGTTTGGG - Intronic
988315654 5:29623374-29623396 CTGCATCTGGTGCTGTGATTTGG + Intergenic
990236230 5:53771367-53771389 CTGGATCAGGCCCAGTGTTGGGG - Intergenic
990566646 5:57036475-57036497 CTGCTTCAGGCTCTTTTTTTTGG - Intergenic
991452101 5:66762965-66762987 GTGTAGCAGGCATTGTGTTTAGG + Intronic
998526172 5:142845252-142845274 CTGTACCAGGAACTGTGTCTAGG + Intronic
999369022 5:151041774-151041796 CTGTCTCAGGCATTGTGCTTTGG - Intronic
999697279 5:154198326-154198348 CTGTACCAAGCATTGTGTTTGGG - Intronic
999862534 5:155663877-155663899 CTGTATCAGGCACTGTTGTGAGG - Intergenic
999881691 5:155871641-155871663 GTGTAGCAGGCACTGTGTTATGG + Intronic
1000248158 5:159467564-159467586 TTGTATCAGGCACTGTGAATAGG - Intergenic
1001277975 5:170364674-170364696 CAGCATTAGGCAATGTGTTGGGG - Intronic
1001913682 5:175541824-175541846 ATACATCAGGCACTGTGCTAAGG + Intergenic
1002051563 5:176574353-176574375 CTGCAGCAGGCACCCTCTTTAGG - Intronic
1002284398 5:178152761-178152783 CTTTTTCAGGCACTGTGTTATGG - Intronic
1002542972 5:179918405-179918427 CTACATCAGGATCTGCGTTTTGG + Intronic
1004350403 6:14885797-14885819 CTCCATCAGGCTCTGGGTTAGGG - Intergenic
1004761895 6:18676524-18676546 CTTCAACAGGCACAGTGTTGTGG + Intergenic
1006058396 6:31402539-31402561 CTGAGGCAGGCACCGTGTTTAGG + Intronic
1006070836 6:31497082-31497104 CTGAGGCAGGCACAGTGTTTAGG + Intronic
1007709036 6:43810055-43810077 CTGGATCAGGCACTGTGTTTAGG - Intergenic
1011443901 6:87417179-87417201 CTGCACCAGGAACTGTTTTCAGG - Intronic
1012114841 6:95283886-95283908 CAGCATCAGGCAGTTTTTTTAGG + Intergenic
1013067288 6:106696058-106696080 ATGGATCAGGCACTGTGGCTGGG + Intergenic
1013225158 6:108115432-108115454 CTGCATTAGGCACTTTGTCTGGG - Intronic
1013388457 6:109657240-109657262 ATGCATCAGGCACTGTTCTAAGG + Intronic
1013588953 6:111604363-111604385 CTGGACCAGTCACTGTGTGTGGG - Intronic
1015165918 6:130199977-130199999 CAGCATCAGGCACCATGTCTTGG + Intronic
1016956069 6:149627876-149627898 CTCCCTCAGGCACTGTGCTGTGG - Intronic
1017029129 6:150205436-150205458 CTCCATCAGGTACTGTAGTTGGG - Intronic
1018369973 6:163158770-163158792 CTGCAGCAGGCACAGGGCTTTGG + Intronic
1021419735 7:20432363-20432385 CTGCATCACGCAATGTTTCTAGG - Intergenic
1021773094 7:24024794-24024816 CTCCAGCAGTCACTGTGTTCTGG + Intergenic
1023891658 7:44396826-44396848 CTGCATCTTGCACTGGGTGTCGG - Intronic
1024234144 7:47385134-47385156 CTGCACCAGGCACCCTGCTTTGG + Intronic
1024413243 7:49071784-49071806 CTGCAACACTCACTGTGTTATGG + Intergenic
1027397518 7:77771409-77771431 AAGCACCAGACACTGTGTTTAGG - Intronic
1029477265 7:100792396-100792418 CTGCACCAGGCACTGCGTGCTGG + Exonic
1030512322 7:110498069-110498091 ATGCATCAGGCCCTGTGTATTGG - Intergenic
1031101325 7:117483876-117483898 CTTCATTAAGCACTGTCTTTAGG - Intronic
1031773709 7:125879562-125879584 CTGCATCTCGCACTGTGATTTGG + Intergenic
1031871795 7:127095743-127095765 CTCTCTCAGGCACAGTGTTTTGG + Intronic
1035475795 7:159143608-159143630 CAGCACCAGGCACTGACTTTGGG + Intronic
1039969166 8:42306957-42306979 CTGTGTCAGGCACTGTGCTCAGG + Intronic
1042608607 8:70573041-70573063 CTGCAGCATACACTGTGTTTAGG - Intergenic
1043325331 8:79043468-79043490 TTACATCAGGCACTGTGCCTAGG - Intergenic
1043326677 8:79060793-79060815 CTGGATCAGTTACTGTGTTCAGG + Intergenic
1044347919 8:91127871-91127893 CTGCAGAAAGCACTGTGTTGAGG - Intronic
1044806313 8:96011879-96011901 CTGCACCAAGCTCTGTGTGTGGG - Intergenic
1045271779 8:100668314-100668336 CTGCCTCAGGCCCTGGTTTTTGG + Intergenic
1045408122 8:101888075-101888097 CTGAATCGGCCACTGTATTTTGG + Intronic
1046975115 8:120266330-120266352 CTGCATCTGGAAATGTCTTTTGG - Intronic
1051806355 9:20996962-20996984 CAGCATCAGGCACTGTGCTATGG - Intergenic
1052756689 9:32549549-32549571 GTGCATCAAGCACTGTGCTAAGG - Intronic
1052881266 9:33602175-33602197 CTGCATCAGGAACTCTGATCTGG - Intergenic
1055045185 9:71916888-71916910 GTGTATTAGGCACTATGTTTAGG + Intronic
1055083775 9:72293334-72293356 CTGTGTCAGGCACTGGGTTTAGG + Intergenic
1056910914 9:90699810-90699832 CCACATCAGGCACTGTTCTTGGG + Intergenic
1057391792 9:94646680-94646702 CTGCTGCAGCCACTGTGTATTGG - Intergenic
1059697980 9:116746879-116746901 ATGCATCAGACACTGCGTTAGGG - Intronic
1060506237 9:124200281-124200303 CTGCATCGGTCACTGAGTTTGGG + Intergenic
1060874784 9:127074922-127074944 CCCCATCAGGCACTGTGTGAAGG + Intronic
1060975639 9:127763385-127763407 CTCCTGCAGGCACTGTGTTGGGG - Intronic
1061546698 9:131308694-131308716 CTGCATCAGGCAGTAGGTTGGGG - Exonic
1186444124 X:9611666-9611688 CTGGCTCAGGCATTTTGTTTGGG + Intronic
1189195975 X:39152703-39152725 CTGCAAAATGCATTGTGTTTTGG + Intergenic
1190897757 X:54638347-54638369 CTGTATCAGGCACTGTGTGAAGG - Intergenic
1190997686 X:55626807-55626829 CTGCATCTGGCAGTATGTTTTGG + Intergenic
1194409763 X:93543509-93543531 CTGCATGGGGCCCTTTGTTTTGG - Intergenic
1195353763 X:104018904-104018926 CTGGATCAGGCAGTGTGTATGGG + Intergenic
1197388237 X:125827046-125827068 CTGCAGCAGGCACTGAGCTGGGG - Intergenic
1197904226 X:131406694-131406716 TTGAATCAGGCACTATGTTCAGG + Intergenic
1198801308 X:140450537-140450559 GTGAATCAGGCACTGTGCTAGGG - Intergenic
1200526430 Y:4279508-4279530 CAGGATCAGTCACTGTGTATTGG - Intergenic
1200757169 Y:7000901-7000923 CTGGCTCAGGCATTTTGTTTGGG + Intronic
1201225757 Y:11817546-11817568 TTCGATCAGGCACTGTGTGTTGG - Intergenic