ID: 1128687797

View in Genome Browser
Species Human (GRCh38)
Location 15:69699705-69699727
Sequence GTCCCAGGCCACGGTGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128687797_1128687805 16 Left 1128687797 15:69699705-69699727 CCGACCCCACCGTGGCCTGGGAC 0: 1
1: 1
2: 2
3: 31
4: 285
Right 1128687805 15:69699744-69699766 TCAGCCTCCCCTCACTGACCAGG 0: 1
1: 0
2: 0
3: 25
4: 234
1128687797_1128687806 17 Left 1128687797 15:69699705-69699727 CCGACCCCACCGTGGCCTGGGAC 0: 1
1: 1
2: 2
3: 31
4: 285
Right 1128687806 15:69699745-69699767 CAGCCTCCCCTCACTGACCAGGG 0: 1
1: 0
2: 0
3: 29
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128687797 Original CRISPR GTCCCAGGCCACGGTGGGGT CGG (reversed) Intergenic
900087580 1:905829-905851 GCTCCAGGCCGCGGTGGGGTGGG - Intergenic
900177663 1:1297983-1298005 GGCCCAGCCCAGGGTGGGGCGGG - Intronic
900265590 1:1755631-1755653 GTCGCAGGCCAGGGTGGGCCGGG + Intronic
901783361 1:11608938-11608960 GTGCCAGCCCACCGTGGGGCAGG + Intergenic
901815992 1:11793934-11793956 GCCCCAGCCCACGATGGGGTCGG + Exonic
902288804 1:15423464-15423486 GCCCCAGGACACGTTGGGGAGGG + Intronic
902653742 1:17853462-17853484 GCCCCAGGCCAAAGTGGGATGGG - Intergenic
902896854 1:19485351-19485373 GTCCCAGGCCAGGGATGGGCAGG + Intronic
903478080 1:23634221-23634243 GTTCCAGGCCAAGGTGGGGTAGG + Intronic
905678272 1:39845748-39845770 GTCCAAGGCCATGCTGGGGTGGG + Intronic
905732140 1:40304580-40304602 GTGCCAGGCCTCGGTGCGGGAGG - Intronic
906488268 1:46247965-46247987 GTCCGAGGCCCGGGTGGGGAGGG - Exonic
907159333 1:52359423-52359445 TTCTCAGGCTGCGGTGGGGTTGG - Intronic
911039490 1:93580401-93580423 GTCTCAGGCGATGGTGGGCTCGG - Intronic
911508487 1:98783863-98783885 ATGCCAGGCCCCGGTGGTGTGGG - Intergenic
915101892 1:153506928-153506950 TTCCAAGGCCAGGGTGGGGGAGG + Intergenic
917062488 1:171056030-171056052 GCCCTAGGCCCCGGTGGTGTGGG - Intronic
917065136 1:171084583-171084605 GTACCAGTCCACAGTGGGTTTGG + Intergenic
919640105 1:200038802-200038824 GCCCCGGGCCAGGGTGGGGTGGG + Intronic
920285319 1:204874654-204874676 GCCCCAGGCCTAGGTGGGGAGGG - Intronic
920285667 1:204877562-204877584 GTTCCAGGCCATGATGGGATGGG - Intronic
920313250 1:205060897-205060919 GTCACAGGCCACTGTGGCGGAGG + Intronic
920357591 1:205386169-205386191 GTCCCAGCGCAGGGTGGGGTGGG + Intronic
920524717 1:206658367-206658389 GCCCCAGGCCAGGTTGGGCTAGG - Intronic
921382263 1:214536152-214536174 GGCCAAGGCCGGGGTGGGGTGGG + Intronic
921440708 1:215182583-215182605 GTCACAGGCCTGGGTAGGGTGGG - Intronic
923338237 1:232987765-232987787 AGCCTAGGCCACGGTGGGGTGGG - Intronic
1064879936 10:20040035-20040057 GTTCTCGGCCATGGTGGGGTGGG + Intronic
1066961387 10:42230787-42230809 GGCCAAGGCCAAGGTGGGGCAGG + Intergenic
1068653486 10:59549960-59549982 GTCCCAGGCCCAGATGGAGTCGG + Intergenic
1069661116 10:70124057-70124079 GTCCCAGGTCTCGGTGGAATCGG - Exonic
1069873130 10:71545246-71545268 CTCCCAGGCCACGGCAGGGGAGG + Intronic
1073250687 10:102118997-102119019 GACCCAGGCCAAGCTGGGCTGGG - Intronic
1075397647 10:122139532-122139554 GTCCCAGGCCTCCGTGGGACTGG + Intronic
1076802423 10:132836702-132836724 GTCCCAGGCCTCCCTGGGGTGGG + Intronic
1077199426 11:1298021-1298043 GTGCCAGGGCCCTGTGGGGTTGG - Intronic
1078856057 11:15207060-15207082 GGGCCAGGCCAGGATGGGGTTGG + Intronic
1082000840 11:47393106-47393128 GCCCCAGGCAGAGGTGGGGTTGG + Intergenic
1082086147 11:48051533-48051555 TTTCCAGGTCACAGTGGGGTGGG + Intronic
1083227849 11:61295667-61295689 GCCCCAGGCCAGGGAGCGGTTGG - Intergenic
1083725062 11:64623567-64623589 CTGCCAGGCCAAGGTGGAGTCGG + Intronic
1083731884 11:64656700-64656722 GGCCCAGGCCATGCTGGGATAGG + Intronic
1083742688 11:64719448-64719470 GTCCCATGCCAGGGTGGGCTGGG + Intronic
1083778481 11:64906229-64906251 GCCCCAGTGCACGGTGGGGCTGG - Intronic
1084165364 11:67372813-67372835 CTCCCAGGCCACGGTGGCCCGGG + Intronic
1084213406 11:67634162-67634184 GGCCGGGGCCACGGTGGGGACGG - Intronic
1084709633 11:70835982-70836004 GTCTCAAGCCACACTGGGGTGGG + Intronic
1087976656 11:104557516-104557538 GTCACAGGCCACCTTGGGGTTGG + Intergenic
1088641780 11:111879662-111879684 GTGCCAGGCCACTGTGAGGGTGG + Intronic
1089790114 11:120936833-120936855 GGGCCAGGCCAGGGAGGGGTGGG - Intronic
1091124676 11:133083439-133083461 TTCCCAGGCTGGGGTGGGGTGGG - Intronic
1092236975 12:6816409-6816431 GGGCCAGGCCAGGGAGGGGTGGG + Intronic
1093388614 12:18589622-18589644 GTCCCAGAAGAAGGTGGGGTAGG - Intronic
1096365523 12:51026029-51026051 GTCCTAGGCCGCGGCGGGGAAGG + Intronic
1096469897 12:51869378-51869400 GCCCCAGGCTACGGCGGGGGAGG - Intergenic
1098396906 12:70028880-70028902 GTGGCAGGCCACGGTGGTCTTGG + Intergenic
1102098333 12:110257969-110257991 GTCCCAGCCCAAGGTGGGGTGGG + Intergenic
1102428472 12:112862957-112862979 GACCCAGTCCATGGAGGGGTGGG + Intronic
1102490932 12:113289098-113289120 GACCCAGGCTACTGTGGGGGTGG - Intronic
1104109410 12:125690617-125690639 GCCCCTGGCCATGATGGGGTTGG + Intergenic
1104853827 12:131892726-131892748 TTTCCAGGCCAGGGTGGGCTGGG + Intergenic
1107380827 13:39855134-39855156 GTTCCCAGCCACGGTGGGATGGG + Intergenic
1109152486 13:58861200-58861222 GTGCCAGGCCAGGGTGGTCTCGG + Intergenic
1112077720 13:95931531-95931553 GTGCCGGGGCAGGGTGGGGTGGG + Intronic
1113788671 13:113016052-113016074 CTCCCAGGCACCGCTGGGGTGGG - Intronic
1115850177 14:37584451-37584473 GGCCCAGGGCCCGGTGGGGAGGG + Intergenic
1116685752 14:48036143-48036165 ATCCAAGGCGCCGGTGGGGTAGG + Intergenic
1118444650 14:65840204-65840226 GTCCCAGGCCAGGGTGCTGAAGG + Intergenic
1118519361 14:66564706-66564728 GTTCCAGGTCACTGTGAGGTAGG + Intronic
1122159045 14:99769458-99769480 GTCCCTGCCCACTGTGGGGGAGG - Intronic
1122580088 14:102766245-102766267 CTTCCAGGGCAGGGTGGGGTGGG - Intergenic
1122632447 14:103113122-103113144 GCCCCAGGCCACGGTGGCACTGG - Intergenic
1122906785 14:104805292-104805314 GGCCCAGGACAGGGTGGGGATGG + Intergenic
1124624557 15:31300514-31300536 GCCCCAGGCCCTGGAGGGGTTGG - Intergenic
1124700119 15:31905334-31905356 CTCCCAGGCGACGCTGGAGTGGG - Intergenic
1125522786 15:40357500-40357522 CTCCCAGGCTGAGGTGGGGTGGG + Intergenic
1127539453 15:59922478-59922500 GTCCAAGGCCGCAGTGAGGTAGG - Intergenic
1128319320 15:66681863-66681885 GTCACAGGCCAAGGTGGGGCAGG + Intronic
1128687797 15:69699705-69699727 GTCCCAGGCCACGGTGGGGTCGG - Intergenic
1129742601 15:77997027-77997049 GTTCCAGGCAGTGGTGGGGTGGG + Exonic
1130232754 15:82109266-82109288 GTCCCAGGATGTGGTGGGGTGGG + Intergenic
1131117665 15:89804681-89804703 GTCCCAGGGCCCAGTGGGCTGGG + Intronic
1132375618 15:101326588-101326610 CTCCCAGGCCCCGCTGGGGCTGG + Intronic
1132496754 16:266954-266976 GCCCCTGGCCATGGAGGGGTGGG + Intronic
1132552124 16:557859-557881 GTCCCAGTGCAGGGTGGGATGGG - Intergenic
1132823205 16:1887864-1887886 GTCCCAGGCCTTGCTGGGGGAGG - Intergenic
1132872628 16:2122542-2122564 GTCCCACCCCACGGCGGGGATGG - Intronic
1134551725 16:15141742-15141764 GTCCCACCCCACGGCGGGGATGG - Intergenic
1134662247 16:15992900-15992922 GGCAAAGGCCACAGTGGGGTGGG - Intronic
1134834159 16:17347314-17347336 GGCCTAGGGCATGGTGGGGTGGG - Intronic
1136615781 16:31397677-31397699 GTCTTGGGCCACGGGGGGGTGGG + Intronic
1136902533 16:34053658-34053680 GGCCCAGGCCTTGGTGGGGGTGG - Intergenic
1138200245 16:55083036-55083058 GTCCCAGGTCCATGTGGGGTGGG + Intergenic
1141437286 16:84007437-84007459 GTGACAGGTCATGGTGGGGTTGG + Intergenic
1141662169 16:85447219-85447241 GGCCCAGACCACGGAGGGCTGGG - Intergenic
1141734247 16:85841539-85841561 GTCTCAGTACATGGTGGGGTTGG - Intergenic
1141858480 16:86700934-86700956 GACCCAGGCCACGGTGGGACGGG - Intergenic
1142133241 16:88440395-88440417 GTCCCAGGCCTGGGTTGGGTCGG - Exonic
1142222677 16:88863433-88863455 GTGCCAGGCCAGCTTGGGGTTGG - Exonic
1142699364 17:1649834-1649856 GTCCCAGTGGAGGGTGGGGTGGG - Exonic
1143146824 17:4781971-4781993 GTGCCAGGGAAGGGTGGGGTGGG + Intronic
1143590979 17:7885593-7885615 GGCTCTGGCCCCGGTGGGGTTGG + Intronic
1145994015 17:29095388-29095410 GACCCAGGTGAGGGTGGGGTGGG + Intronic
1146008598 17:29177764-29177786 GTCCCAGGCCTGAGTGTGGTGGG - Intronic
1146911624 17:36651975-36651997 GTCCCAGGGCAGGGGGTGGTGGG - Intergenic
1148469015 17:47882069-47882091 TTCCCAGGACACGGTGGGTGGGG - Intergenic
1148588669 17:48799229-48799251 GTCACAGCCCACTGTGGGGAGGG - Intronic
1148717880 17:49728720-49728742 GGCCCAGGCCAGGGTGGGTGAGG - Intronic
1149318180 17:55458509-55458531 GTGGCAGGCCAGGGTGGTGTCGG - Intergenic
1149560677 17:57605863-57605885 ACCCCAGGGCACGGTGGGCTGGG - Intronic
1149657286 17:58316836-58316858 GGCCCAGGCCATGCTGGTGTGGG + Intronic
1149993734 17:61396523-61396545 GTCCCAGGTCTGGTTGGGGTGGG - Intergenic
1150571097 17:66387873-66387895 GTCCCACTCCAAGGTGAGGTGGG - Intronic
1150908236 17:69361525-69361547 GTTCCATGCCACAGTGGGGAAGG - Intergenic
1151457061 17:74232589-74232611 GCCCCAGGCCCTGGTGGGGAAGG + Intronic
1151612145 17:75183085-75183107 GGCCCAGGACGCGGTGGCGTGGG - Intergenic
1151940369 17:77288119-77288141 ACCCCAGGCCGGGGTGGGGTAGG - Intronic
1152202078 17:78952956-78952978 CACCCAGGCCTCGGTGGGCTCGG + Intergenic
1152703225 17:81829782-81829804 GTCCCAGCACTGGGTGGGGTGGG - Intronic
1156036114 18:32770123-32770145 GTCCCTGGACACGGTGGAGGAGG - Exonic
1159889718 18:73942249-73942271 GTCACATCCCACGGTGGGGGAGG + Intergenic
1160821737 19:1062162-1062184 TTCCCGGGCCACGCTGGGGATGG - Exonic
1161033405 19:2070602-2070624 GTCCAAGGCCACAGCGGGCTAGG + Intergenic
1161070008 19:2255332-2255354 GTCCCAGGCCAGGCTGGGAGGGG + Exonic
1161160826 19:2761119-2761141 AGCCCACGCCAGGGTGGGGTGGG + Intronic
1161283704 19:3458495-3458517 CTCCCAGGCTTGGGTGGGGTGGG - Intronic
1161590836 19:5128444-5128466 GTCCCAGTCCCCGGTGAGGCTGG + Intronic
1162567391 19:11451787-11451809 GGCCTAGGCCTCGGTGGGGGGGG + Exonic
1162733129 19:12730929-12730951 GTCCCAGGCCATGGGCAGGTGGG + Exonic
1162809694 19:13156203-13156225 GTGCCCGGCCACCGTGGGGCTGG + Intergenic
1162869086 19:13572190-13572212 GTCCCAGGCTACTGTGAGTTGGG + Intronic
1162999296 19:14356123-14356145 GTCCTGGGACATGGTGGGGTGGG - Intergenic
1163035364 19:14566344-14566366 GTCCCAGAGCACTGTGGGGGAGG + Intronic
1163064835 19:14785229-14785251 GTCCTGGGACATGGTGGGGTGGG + Intergenic
1163797315 19:19345116-19345138 GACCCAAGCCAATGTGGGGTGGG - Intronic
1164108985 19:22137037-22137059 GACCCAGTCCACAGGGGGGTTGG + Intergenic
1164191276 19:22919438-22919460 GACCCAGTCCACAGGGGGGTTGG + Intergenic
1164527333 19:29021929-29021951 TTCCCAGGCCATGCTGGGGGCGG + Intergenic
1165090798 19:33387558-33387580 CTCCCATCCCATGGTGGGGTGGG - Intronic
1165901824 19:39172890-39172912 GTCCCAGGCAATGGTGGGTGGGG - Intronic
1166161122 19:40954156-40954178 TTCCCAGGCCAAGCTGGTGTGGG + Intergenic
1167427292 19:49436052-49436074 CTCCCAGGCTACGGTGCAGTGGG - Intronic
1167459052 19:49614799-49614821 GGCCCAGGGCACGGGGGTGTTGG + Intronic
1167608326 19:50493497-50493519 CTCCCAGGTCAGGGTGGGGTGGG - Intergenic
1168266065 19:55224738-55224760 GTCCCTGGGCTCTGTGGGGTCGG - Intergenic
1168332797 19:55579582-55579604 GGCCTCGGCCACGGTGAGGTGGG + Exonic
926125488 2:10269433-10269455 CTCTCAGGCCGCGGTGGGGCTGG - Intergenic
927126082 2:20012991-20013013 GGCGCAGGCCCCGCTGGGGTGGG - Intergenic
927154627 2:20214371-20214393 GTCCCAGGGGAGGGTGGGGCTGG + Intronic
927908094 2:26876333-26876355 GTCCCAGTGCACGGTGGAGTGGG + Intronic
927981499 2:27377672-27377694 GTGCATGGCCACGGTGGGGCAGG - Exonic
929453595 2:42051660-42051682 GCCCCAGACCCTGGTGGGGTGGG - Intronic
930693881 2:54391448-54391470 GCCCCAGGCCTCAGAGGGGTGGG + Intergenic
931459780 2:62440604-62440626 GTTCCAGGCCATGATGGGCTGGG - Intergenic
932599174 2:73112384-73112406 GGGCCAGGCCACGGTGGCGCTGG - Exonic
932765210 2:74464969-74464991 GTCCGGGGCCACGGCGGGGCTGG + Exonic
937136721 2:119559822-119559844 GTCTCAGGCCTGTGTGGGGTGGG + Intronic
937293882 2:120798405-120798427 TTCACAGGCCACGCTGGGGCCGG + Intronic
942138478 2:172953748-172953770 GTCCCAGCATTCGGTGGGGTGGG + Intronic
945197632 2:207251948-207251970 GGCACAGGCCACAGAGGGGTAGG - Intergenic
946628064 2:221636308-221636330 GTACCAAGCCATAGTGGGGTTGG + Intergenic
947384271 2:229575636-229575658 TTCCCAGGCTGCGGTGGTGTTGG - Intronic
947592359 2:231393049-231393071 GTCCCAAGCCAAGGTGGAGGTGG - Intergenic
947712152 2:232322385-232322407 GTCCCATGCCACAGTGTGGCAGG - Intronic
947787804 2:232839899-232839921 GTCCCAGGCCACGCTGTCGTTGG + Exonic
947948292 2:234125292-234125314 GTCCAGGGGCAGGGTGGGGTGGG + Intergenic
948164373 2:235850068-235850090 GGGCCAGGACACCGTGGGGTGGG - Intronic
948465165 2:238148673-238148695 GTCCCCAGTCAGGGTGGGGTGGG + Intronic
948807993 2:240461188-240461210 CTCCCAGGCCGCTGTGGGGAGGG - Intronic
1168892785 20:1305716-1305738 GCACCAGGCCGCTGTGGGGTGGG - Exonic
1170542947 20:17407205-17407227 GTCCCAGGCCTCTCTGAGGTTGG + Intronic
1171034602 20:21705417-21705439 GTCCCAGGCCCAGCTGGGGTTGG + Intergenic
1171517614 20:25750454-25750476 GTGGCAGGCCACGGTGGTCTTGG + Intergenic
1172841178 20:37903459-37903481 GTCTCCGGCCACGGTGAGTTCGG + Exonic
1173943145 20:46929088-46929110 GGCTCAGGGAACGGTGGGGTGGG + Intronic
1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG + Intergenic
1175183132 20:57162395-57162417 GGCCCAGCCCACACTGGGGTTGG - Intergenic
1175844497 20:62051440-62051462 GTCCCAGGGCCCTGTGGGGAGGG - Intronic
1175977480 20:62718332-62718354 GTCCTAGGCCAGGGTGGGGGTGG + Intronic
1176236453 20:64055953-64055975 GCCCCAGGCAGCCGTGGGGTCGG - Intronic
1176414671 21:6467683-6467705 GTCCCAGGCTGCGGCGGGGTGGG - Intergenic
1178438620 21:32581035-32581057 GTGGCAGGCCACGGTGGTCTTGG - Intronic
1179690171 21:43076005-43076027 GTCCCAGGCTGCGGCGGGGTGGG - Intronic
1180166423 21:46033124-46033146 GTCCCGGGCCTCGGAGGGGGCGG + Intergenic
1180166438 21:46033159-46033181 GTCCCGGGCCTCGGAGGGGGCGG + Intergenic
1180166453 21:46033194-46033216 GTCCCGGGCCTCGGAGGGGGCGG + Intergenic
1180166468 21:46033229-46033251 GTCCCGGGCCTCGGAGGGGGCGG + Intergenic
1180742149 22:18061246-18061268 GTCCAAGGCGACGGTGGGTGGGG + Intergenic
1180920185 22:19517612-19517634 GGCCCAGGTCAAGGTGGGGCAGG + Intronic
1180949615 22:19715130-19715152 GTGGCAGGCCACGCTGGGGGAGG + Intronic
1180981164 22:19878668-19878690 GTCCCAGGCCTGGGTGGGACAGG - Intronic
1181177752 22:21047471-21047493 GCCCCAGGCCACGGTGCCGGAGG - Exonic
1181430553 22:22879101-22879123 GTCCCAGACCACAGTGGGTCTGG + Intronic
1181496270 22:23288966-23288988 CCCCCAGGCCACGGTGGCATTGG - Intronic
1181521387 22:23450552-23450574 GTCCCAGCCCCGGGCGGGGTTGG - Intergenic
1181539237 22:23564553-23564575 GGGCCAGGCCATGGTGGGCTTGG - Intergenic
1181694976 22:24588484-24588506 GTGCCAGGCCACAGCCGGGTTGG - Intronic
1182446915 22:30395096-30395118 CTCCCAGGCCAAGGTGTGGACGG - Intronic
1182487746 22:30649474-30649496 GGGCCAGCCCACGGCGGGGTGGG + Intronic
1183648118 22:39138498-39138520 CACCCAGGGCACTGTGGGGTGGG - Intronic
1184236076 22:43183683-43183705 GCCCCAGGTCAAGGTGGGATGGG + Intronic
1184443777 22:44535446-44535468 CTCCCTGACCACCGTGGGGTAGG - Intergenic
1184679300 22:46061745-46061767 GTCCCAGGCCGGGGTCGGGTCGG - Intronic
1184842231 22:47058730-47058752 GGCCCAGGCCTTGGTGGGGTTGG + Intronic
1184862395 22:47180450-47180472 GTTGCAAGCCACTGTGGGGTGGG - Intergenic
1185006131 22:48277973-48277995 GGCCCAGGGGAGGGTGGGGTGGG + Intergenic
1185231936 22:49688480-49688502 GTCCCAGGCCTGGCTGGTGTGGG - Intergenic
1185409319 22:50674147-50674169 GTCCTAGGCCTCGGTGCGGGGGG - Intergenic
950092314 3:10304703-10304725 TTCCCAAGCAACGATGGGGTTGG - Intronic
950362314 3:12458350-12458372 TTCCCAGGCTATGGTGTGGTTGG - Intergenic
950577964 3:13844433-13844455 TCCCCAGGCCATGGTGGGGAAGG - Intronic
952884891 3:38006273-38006295 AGCCCAGGCCACTGTGGGGAAGG - Intronic
953884517 3:46707781-46707803 GTCCCAGGCCCCGGGAGGCTGGG - Intronic
953923664 3:46969206-46969228 GTCCCTGGCCAGGTTGGGGGAGG - Intronic
954117026 3:48472685-48472707 GTCCCAGGGCGGGGTAGGGTGGG - Intronic
954413823 3:50383237-50383259 GCCTCAGGCCAGGGTGGGGAAGG - Intronic
957792461 3:84958925-84958947 GTCCCTGGCCGGGGTGGGGGCGG + Intergenic
961469185 3:127100813-127100835 GCCCCAGGCCACGGAGGAGGCGG + Intergenic
963238655 3:142981198-142981220 GTCCCAGGTCAAGGTCTGGTAGG + Intronic
964645742 3:158956836-158956858 GTCCCAGGCAGCAGTGGGGAGGG + Intergenic
967242730 3:187456904-187456926 GTCCCAGGCTCAGGTGGGGATGG - Intergenic
968645779 4:1739889-1739911 GTCCCAGGCCAGGTGGGGATGGG - Intronic
968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG + Intronic
968935267 4:3606999-3607021 GGACCAAGCCACAGTGGGGTGGG + Intergenic
969691254 4:8705393-8705415 TCCCCAGGCCACCCTGGGGTGGG - Intergenic
975922444 4:79408237-79408259 TTCCCAGGCCACGGCGGTGTTGG + Exonic
978727140 4:111982834-111982856 TTCTCAGGCTACGGTGGGGTAGG - Intergenic
979228081 4:118313274-118313296 GTTCCAGGCGACAGTGGGGAAGG - Exonic
980958840 4:139454490-139454512 CGACCAGCCCACGGTGGGGTTGG - Intronic
985031695 4:185796524-185796546 TTCCCTGGTCACGGTGGGGCTGG + Intronic
985031709 4:185796574-185796596 TTCCCTGGTCACGGTGGGGCTGG + Intronic
985031723 4:185796624-185796646 TTCCCTGGTCACGGTGGGGCTGG + Intronic
985031737 4:185796674-185796696 TTCCCTGGTCACGGTGGGGCTGG + Intronic
985031751 4:185796724-185796746 TTCCCTGGTCACGGTGGGGCTGG + Intronic
985031765 4:185796774-185796796 TTCCCTGGTCACGGTGGGGCTGG + Intronic
985031779 4:185796824-185796846 TTCCCTGGTCACGGTGGGGCTGG + Intronic
985493892 5:193751-193773 GTCCCAGTCCTGGGTGGGGAGGG + Intronic
985575088 5:670204-670226 GTCACAGGCCCCGCTGGGCTCGG + Intronic
985579949 5:691335-691357 GTCCCAGGCCACAGGGAGCTGGG + Intronic
985594796 5:783394-783416 GTCCCAGGCCACAGGGAGCTGGG + Intergenic
985719687 5:1482538-1482560 GAGCCAGGGCAGGGTGGGGTGGG + Intronic
985719703 5:1482574-1482596 GAGCCAGGGCAGGGTGGGGTGGG + Intronic
986942477 5:12971186-12971208 GTCAAAGGCCACTGTGGGTTAGG - Intergenic
988064548 5:26218119-26218141 GTCCTAGGCAGGGGTGGGGTGGG - Intergenic
988639528 5:33026042-33026064 GTCCCTGGGCACAATGGGGTGGG + Intergenic
989291158 5:39767936-39767958 GTCCCAGTTCTGGGTGGGGTTGG + Intergenic
989665201 5:43846177-43846199 GTCCCAGGCATCTGGGGGGTGGG + Intergenic
997725974 5:136120123-136120145 GTCCCAGGCTAGCCTGGGGTCGG + Intergenic
997792473 5:136772982-136773004 GTCCCGGGACACGAGGGGGTAGG - Intergenic
1001562178 5:172677039-172677061 GTCAGTGGCCACGGTGGGGGAGG + Intronic
1001920714 5:175597180-175597202 GTCCCAGGCCCCGGGGGAGCAGG - Intergenic
1002053909 5:176587573-176587595 GGCCCAGCCCTCGGTGGTGTGGG - Intronic
1002187119 5:177459570-177459592 GCCCCAGGCCTCGGCGGGGGTGG - Intronic
1002450735 5:179317113-179317135 GACCCAGGCCACGTGGGGTTGGG - Intronic
1002709270 5:181184429-181184451 GCCACAGGCCGCGCTGGGGTAGG - Intergenic
1003569661 6:7247619-7247641 GCCCCAGGCCGCTGTGGGGCAGG + Intronic
1005652387 6:27896109-27896131 GTCCCAGCCCTCAGTGTGGTTGG - Intergenic
1006982084 6:38154935-38154957 GCCCCAGGCGTGGGTGGGGTGGG + Intergenic
1007505068 6:42329281-42329303 GTCAGTGGCCAGGGTGGGGTGGG + Intronic
1007760236 6:44128738-44128760 CTCCCAGGCCAGGGTGAGGTGGG + Intronic
1009995167 6:70888814-70888836 GGCCCAGGCCAGGGTAGGGAGGG - Intronic
1015309335 6:131748856-131748878 TTTCCAGGCCATGGTGGGGCAGG - Intergenic
1017558582 6:155602015-155602037 CTCCCAGACCACAGTGGGCTTGG + Intergenic
1018036499 6:159887001-159887023 GTGCCAGGGCAGGGTGGGGAAGG - Intergenic
1018426552 6:163688045-163688067 TTCCCAGTCCACTGTGGGGAAGG - Intergenic
1019143551 6:169962764-169962786 GTCCTCGGCCACAGTGGGGCTGG + Intergenic
1019589948 7:1825919-1825941 GTCCCAGCCCCAGGCGGGGTTGG + Intronic
1019735262 7:2647222-2647244 GACCCCGGCCACCGTGCGGTTGG - Exonic
1019807628 7:3139929-3139951 GTGACAGCCCAGGGTGGGGTAGG + Intergenic
1021655178 7:22867652-22867674 CTCTGAGGCCACAGTGGGGTGGG - Intergenic
1023237695 7:38107682-38107704 GTACCAGGCCATGCTGTGGTTGG + Intergenic
1023705069 7:42932499-42932521 TTCCCAGTCCTCCGTGGGGTAGG + Exonic
1023875033 7:44282291-44282313 GGCCCAGCCCGTGGTGGGGTGGG - Intronic
1025562371 7:62383299-62383321 GGCCCAGGCCTTGGTGGGGGTGG - Intergenic
1027045957 7:74991569-74991591 AGCCCAGGCCAGGGTGGAGTTGG + Intronic
1029386866 7:100249002-100249024 AGCCCAGGCCAGGGTGGAGTTGG - Intronic
1029420082 7:100467768-100467790 CTCCCAGGCCCCGGTGGGGCGGG + Intronic
1031881904 7:127207688-127207710 GTTCCTGGCCACGGTGCGATGGG + Intronic
1031979766 7:128116945-128116967 GTCCCAGGACACTGTGAGGTCGG - Intergenic
1032977451 7:137241909-137241931 GTCCCAGGCCAGCCTGTGGTGGG + Intronic
1035036356 7:155897790-155897812 GTCCCAGTCCATGGTGGGGCAGG - Intergenic
1035179388 7:157078215-157078237 GGCCCAGCCCACGCTGAGGTTGG + Intergenic
1035821520 8:2597561-2597583 GGCCCAGGCTACAGTGAGGTTGG - Intergenic
1037820160 8:22131353-22131375 GGACCAGGCCACGGTTGGGCGGG + Exonic
1039820441 8:41129734-41129756 GACCCAGGCCATGGTGGTGTGGG - Intergenic
1045008422 8:97936354-97936376 GTGCCTGGCCTGGGTGGGGTGGG - Intronic
1047725779 8:127682918-127682940 GTCTTTGGCCATGGTGGGGTGGG - Intergenic
1048967782 8:139626665-139626687 GTCCCAGGGAACTGTGGGCTGGG - Intronic
1049158898 8:141084779-141084801 GTCCCAGGCCACGCTGAAGGTGG + Intergenic
1049159788 8:141089796-141089818 GTCCCTTTCCAGGGTGGGGTGGG - Intergenic
1049466345 8:142752752-142752774 GCCCCAGGCCATGGTGGCGGAGG - Intergenic
1049527135 8:143133062-143133084 ATGCCAGGCGACGGTGGGGCTGG - Intergenic
1049848735 8:144819480-144819502 GCCCCAGGCCACTGTTGGGGAGG + Intergenic
1049998490 9:1052162-1052184 GTCTCAGGCCACAGTGGAGGTGG + Intronic
1050352815 9:4756444-4756466 GTCCCTGGCCATGATGGGATGGG - Intergenic
1052122657 9:24737960-24737982 GTGGCAGGCCAGGGTGGTGTTGG - Intergenic
1053164078 9:35832490-35832512 GCCCCTGGCCACTGTGGGGATGG + Intronic
1053319228 9:37080290-37080312 GTCCAGGGCCTCGGTGGGGGTGG + Intergenic
1054158715 9:61658968-61658990 GGCCCAGGCCAGGCTGGGGGAGG - Intergenic
1054454917 9:65424903-65424925 GGACCAAGCCACAGTGGGGTGGG - Intergenic
1054478489 9:65589973-65589995 GGCCCAGGCCAGGCTGGGGGAGG - Intergenic
1057305965 9:93912211-93912233 GGCCCAGGCCAGGATGGGGCTGG + Intergenic
1060406647 9:123376192-123376214 GACCCAGGTCACAGTGGGCTGGG + Intronic
1060584847 9:124779567-124779589 GTCCCAGGACAAGCTGGGGCTGG + Intronic
1060989981 9:127843065-127843087 GTCCCATGGCAGGGTCGGGTGGG - Intronic
1061166028 9:128922547-128922569 GACCCAGGGTAGGGTGGGGTGGG + Intronic
1061543470 9:131290509-131290531 GGTCCCGGCCAGGGTGGGGTTGG - Intronic
1062024037 9:134332301-134332323 GTCCCAGGGCAGGGCAGGGTAGG + Intronic
1062106417 9:134757394-134757416 GTCCCAGGCCACGGGGGGCAGGG + Intronic
1062235669 9:135506491-135506513 GGCTCAGGGCAGGGTGGGGTGGG + Intergenic
1062452354 9:136620992-136621014 GCCCCAGGTGGCGGTGGGGTGGG - Intergenic
1062525900 9:136978022-136978044 GTGCCAGGACACGGGCGGGTGGG + Intronic
1062627405 9:137449540-137449562 CTGCGGGGCCACGGTGGGGTGGG - Intronic
1185451575 X:283595-283617 GTGCCAGGCCCGGGTGGGGGCGG + Intronic
1187419626 X:19122764-19122786 GCCCCCGGCTGCGGTGGGGTGGG - Intergenic
1191141601 X:57121140-57121162 GCGCCAGGCAAGGGTGGGGTGGG - Intronic
1191143242 X:57137107-57137129 GCGCCAGGCAAGGGTGGGGTGGG - Intronic
1191984799 X:66968478-66968500 GCCCAAGGCCTTGGTGGGGTAGG - Intergenic
1200077381 X:153557886-153557908 GTCACATGTCACGGTGGGGGGGG - Intronic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic